ID: 1067095135

View in Genome Browser
Species Human (GRCh38)
Location 10:43294895-43294917
Sequence ACAGGGATTCGGGGTGCTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067095135_1067095143 -5 Left 1067095135 10:43294895-43294917 CCCTGAGCACCCCGAATCCCTGT No data
Right 1067095143 10:43294913-43294935 CCTGTACCTATAGGTAGAGCTGG No data
1067095135_1067095145 3 Left 1067095135 10:43294895-43294917 CCCTGAGCACCCCGAATCCCTGT No data
Right 1067095145 10:43294921-43294943 TATAGGTAGAGCTGGACTCCAGG No data
1067095135_1067095147 12 Left 1067095135 10:43294895-43294917 CCCTGAGCACCCCGAATCCCTGT No data
Right 1067095147 10:43294930-43294952 AGCTGGACTCCAGGGCACTCTGG No data
1067095135_1067095149 28 Left 1067095135 10:43294895-43294917 CCCTGAGCACCCCGAATCCCTGT No data
Right 1067095149 10:43294946-43294968 ACTCTGGCTTCATCCCCTGCTGG No data
1067095135_1067095150 29 Left 1067095135 10:43294895-43294917 CCCTGAGCACCCCGAATCCCTGT No data
Right 1067095150 10:43294947-43294969 CTCTGGCTTCATCCCCTGCTGGG No data
1067095135_1067095146 4 Left 1067095135 10:43294895-43294917 CCCTGAGCACCCCGAATCCCTGT No data
Right 1067095146 10:43294922-43294944 ATAGGTAGAGCTGGACTCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067095135 Original CRISPR ACAGGGATTCGGGGTGCTCA GGG (reversed) Intergenic