ID: 1067096936

View in Genome Browser
Species Human (GRCh38)
Location 10:43307606-43307628
Sequence CCACCATGCCTGGCCAAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 3052
Summary {0: 6, 1: 28, 2: 174, 3: 703, 4: 2141}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067096936_1067096948 21 Left 1067096936 10:43307606-43307628 CCAGTTTTGGCCAGGCATGGTGG 0: 6
1: 28
2: 174
3: 703
4: 2141
Right 1067096948 10:43307650-43307672 CTTTGGGAGGCCGAGGCGGGTGG 0: 39056
1: 119917
2: 190535
3: 147315
4: 99766
1067096936_1067096947 18 Left 1067096936 10:43307606-43307628 CCAGTTTTGGCCAGGCATGGTGG 0: 6
1: 28
2: 174
3: 703
4: 2141
Right 1067096947 10:43307647-43307669 GTACTTTGGGAGGCCGAGGCGGG 0: 1938
1: 93311
2: 231253
3: 239223
4: 158320
1067096936_1067096939 4 Left 1067096936 10:43307606-43307628 CCAGTTTTGGCCAGGCATGGTGG 0: 6
1: 28
2: 174
3: 703
4: 2141
Right 1067096939 10:43307633-43307655 CGCCTGTAATCCCAGTACTTTGG 0: 2820
1: 133074
2: 281946
3: 224039
4: 151667
1067096936_1067096940 5 Left 1067096936 10:43307606-43307628 CCAGTTTTGGCCAGGCATGGTGG 0: 6
1: 28
2: 174
3: 703
4: 2141
Right 1067096940 10:43307634-43307656 GCCTGTAATCCCAGTACTTTGGG 0: 5907
1: 232259
2: 277417
3: 182413
4: 140180
1067096936_1067096944 14 Left 1067096936 10:43307606-43307628 CCAGTTTTGGCCAGGCATGGTGG 0: 6
1: 28
2: 174
3: 703
4: 2141
Right 1067096944 10:43307643-43307665 CCCAGTACTTTGGGAGGCCGAGG 0: 2664
1: 125841
2: 272203
3: 213195
4: 126814
1067096936_1067096946 17 Left 1067096936 10:43307606-43307628 CCAGTTTTGGCCAGGCATGGTGG 0: 6
1: 28
2: 174
3: 703
4: 2141
Right 1067096946 10:43307646-43307668 AGTACTTTGGGAGGCCGAGGCGG 0: 1945
1: 95817
2: 190949
3: 137757
4: 71500
1067096936_1067096942 8 Left 1067096936 10:43307606-43307628 CCAGTTTTGGCCAGGCATGGTGG 0: 6
1: 28
2: 174
3: 703
4: 2141
Right 1067096942 10:43307637-43307659 TGTAATCCCAGTACTTTGGGAGG 0: 8216
1: 308215
2: 267713
3: 148631
4: 131048

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067096936 Original CRISPR CCACCATGCCTGGCCAAAAC TGG (reversed) Intergenic
Too many off-targets to display for this crispr