ID: 1067100034

View in Genome Browser
Species Human (GRCh38)
Location 10:43328102-43328124
Sequence GCCTGAAGTCGGCTCATGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067100034_1067100043 17 Left 1067100034 10:43328102-43328124 CCCACCATGAGCCGACTTCAGGC No data
Right 1067100043 10:43328142-43328164 CTTCCACACACAGTGTTCAAGGG No data
1067100034_1067100040 -8 Left 1067100034 10:43328102-43328124 CCCACCATGAGCCGACTTCAGGC No data
Right 1067100040 10:43328117-43328139 CTTCAGGCTTCTTGGGACCGAGG No data
1067100034_1067100042 16 Left 1067100034 10:43328102-43328124 CCCACCATGAGCCGACTTCAGGC No data
Right 1067100042 10:43328141-43328163 GCTTCCACACACAGTGTTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067100034 Original CRISPR GCCTGAAGTCGGCTCATGGT GGG (reversed) Intergenic
No off target data available for this crispr