ID: 1067104148

View in Genome Browser
Species Human (GRCh38)
Location 10:43354485-43354507
Sequence CCAATGGATGATATCACAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067104148_1067104154 14 Left 1067104148 10:43354485-43354507 CCCACTGTGATATCATCCATTGG No data
Right 1067104154 10:43354522-43354544 CGCTGTCCCTTTGCAGCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067104148 Original CRISPR CCAATGGATGATATCACAGT GGG (reversed) Intergenic
No off target data available for this crispr