ID: 1067104363

View in Genome Browser
Species Human (GRCh38)
Location 10:43356153-43356175
Sequence GCCAGCTGATCCACAAGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067104362_1067104363 -1 Left 1067104362 10:43356131-43356153 CCAGTTTATTGATCTGGGTGGTG 0: 99
1: 167
2: 268
3: 314
4: 430
Right 1067104363 10:43356153-43356175 GCCAGCTGATCCACAAGTGCAGG No data
1067104358_1067104363 28 Left 1067104358 10:43356102-43356124 CCTGGGTGTGGAACACAATGTCA No data
Right 1067104363 10:43356153-43356175 GCCAGCTGATCCACAAGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067104363 Original CRISPR GCCAGCTGATCCACAAGTGC AGG Intergenic
No off target data available for this crispr