ID: 1067107845

View in Genome Browser
Species Human (GRCh38)
Location 10:43377460-43377482
Sequence GAGTCTGCACAGGTGGACCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067107840_1067107845 -4 Left 1067107840 10:43377441-43377463 CCAGCCCAGAGGCAGCGCTGAGT No data
Right 1067107845 10:43377460-43377482 GAGTCTGCACAGGTGGACCTAGG No data
1067107842_1067107845 -9 Left 1067107842 10:43377446-43377468 CCAGAGGCAGCGCTGAGTCTGCA No data
Right 1067107845 10:43377460-43377482 GAGTCTGCACAGGTGGACCTAGG No data
1067107841_1067107845 -8 Left 1067107841 10:43377445-43377467 CCCAGAGGCAGCGCTGAGTCTGC No data
Right 1067107845 10:43377460-43377482 GAGTCTGCACAGGTGGACCTAGG No data
1067107835_1067107845 18 Left 1067107835 10:43377419-43377441 CCAGCAGCCCCAGGTGGTATGGC No data
Right 1067107845 10:43377460-43377482 GAGTCTGCACAGGTGGACCTAGG No data
1067107837_1067107845 10 Left 1067107837 10:43377427-43377449 CCCAGGTGGTATGGCCAGCCCAG No data
Right 1067107845 10:43377460-43377482 GAGTCTGCACAGGTGGACCTAGG No data
1067107838_1067107845 9 Left 1067107838 10:43377428-43377450 CCAGGTGGTATGGCCAGCCCAGA No data
Right 1067107845 10:43377460-43377482 GAGTCTGCACAGGTGGACCTAGG No data
1067107836_1067107845 11 Left 1067107836 10:43377426-43377448 CCCCAGGTGGTATGGCCAGCCCA No data
Right 1067107845 10:43377460-43377482 GAGTCTGCACAGGTGGACCTAGG No data
1067107832_1067107845 24 Left 1067107832 10:43377413-43377435 CCTGTACCAGCAGCCCCAGGTGG No data
Right 1067107845 10:43377460-43377482 GAGTCTGCACAGGTGGACCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067107845 Original CRISPR GAGTCTGCACAGGTGGACCT AGG Intergenic
No off target data available for this crispr