ID: 1067107944

View in Genome Browser
Species Human (GRCh38)
Location 10:43377982-43378004
Sequence ATACATGTGAAGGTGGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067107944_1067107953 -2 Left 1067107944 10:43377982-43378004 CCCACCTCCACCTTCACATGTAT No data
Right 1067107953 10:43378003-43378025 ATCCTGGGGCCACGTCGTGGTGG No data
1067107944_1067107952 -5 Left 1067107944 10:43377982-43378004 CCCACCTCCACCTTCACATGTAT No data
Right 1067107952 10:43378000-43378022 TGTATCCTGGGGCCACGTCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067107944 Original CRISPR ATACATGTGAAGGTGGAGGT GGG (reversed) Intergenic
No off target data available for this crispr