ID: 1067110461

View in Genome Browser
Species Human (GRCh38)
Location 10:43396719-43396741
Sequence GCTGCTGGAGTGCCGTGAGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 276
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 253}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067110461_1067110477 25 Left 1067110461 10:43396719-43396741 CCTGCTCACGGCACTCCAGCAGC 0: 1
1: 0
2: 1
3: 21
4: 253
Right 1067110477 10:43396767-43396789 GGTCGGCCCCAGGGCCTGCGCGG 0: 1
1: 0
2: 2
3: 26
4: 216
1067110461_1067110478 26 Left 1067110461 10:43396719-43396741 CCTGCTCACGGCACTCCAGCAGC 0: 1
1: 0
2: 1
3: 21
4: 253
Right 1067110478 10:43396768-43396790 GTCGGCCCCAGGGCCTGCGCGGG 0: 1
1: 0
2: 0
3: 16
4: 234
1067110461_1067110476 16 Left 1067110461 10:43396719-43396741 CCTGCTCACGGCACTCCAGCAGC 0: 1
1: 0
2: 1
3: 21
4: 253
Right 1067110476 10:43396758-43396780 CGGCAGGAAGGTCGGCCCCAGGG 0: 1
1: 0
2: 2
3: 11
4: 147
1067110461_1067110463 -9 Left 1067110461 10:43396719-43396741 CCTGCTCACGGCACTCCAGCAGC 0: 1
1: 0
2: 1
3: 21
4: 253
Right 1067110463 10:43396733-43396755 TCCAGCAGCCTCGGACCGCCCGG 0: 1
1: 0
2: 0
3: 13
4: 141
1067110461_1067110475 15 Left 1067110461 10:43396719-43396741 CCTGCTCACGGCACTCCAGCAGC 0: 1
1: 0
2: 1
3: 21
4: 253
Right 1067110475 10:43396757-43396779 CCGGCAGGAAGGTCGGCCCCAGG 0: 1
1: 0
2: 1
3: 12
4: 121
1067110461_1067110470 8 Left 1067110461 10:43396719-43396741 CCTGCTCACGGCACTCCAGCAGC 0: 1
1: 0
2: 1
3: 21
4: 253
Right 1067110470 10:43396750-43396772 GCCCGGCCCGGCAGGAAGGTCGG 0: 1
1: 0
2: 2
3: 135
4: 4617
1067110461_1067110468 4 Left 1067110461 10:43396719-43396741 CCTGCTCACGGCACTCCAGCAGC 0: 1
1: 0
2: 1
3: 21
4: 253
Right 1067110468 10:43396746-43396768 GACCGCCCGGCCCGGCAGGAAGG 0: 1
1: 0
2: 0
3: 10
4: 133
1067110461_1067110467 0 Left 1067110461 10:43396719-43396741 CCTGCTCACGGCACTCCAGCAGC 0: 1
1: 0
2: 1
3: 21
4: 253
Right 1067110467 10:43396742-43396764 CTCGGACCGCCCGGCCCGGCAGG 0: 1
1: 0
2: 1
3: 11
4: 136
1067110461_1067110465 -4 Left 1067110461 10:43396719-43396741 CCTGCTCACGGCACTCCAGCAGC 0: 1
1: 0
2: 1
3: 21
4: 253
Right 1067110465 10:43396738-43396760 CAGCCTCGGACCGCCCGGCCCGG 0: 1
1: 0
2: 2
3: 21
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067110461 Original CRISPR GCTGCTGGAGTGCCGTGAGC AGG (reversed) Exonic
900146025 1:1158951-1158973 GCTGCTGGAGGACCCCGAGCTGG - Intergenic
900244183 1:1630043-1630065 GCTGCAGGTGGGCTGTGAGCTGG - Intronic
900331996 1:2139919-2139941 GCTGCTGGAGAGCCCTCTGCTGG + Intronic
900417108 1:2540335-2540357 GCAGCTGGCGTGCCCTGCGCAGG - Intergenic
901026812 1:6282628-6282650 GCTGTTGGAGGGCGGTTAGCAGG + Intronic
901646006 1:10717068-10717090 GCTGCTGGAGGGACAGGAGCAGG + Intronic
901766109 1:11501168-11501190 GCTTCTGGAGTACCCTGGGCTGG + Exonic
901987766 1:13089755-13089777 GCTTCTGGAGTGACCAGAGCAGG - Intergenic
901994046 1:13137012-13137034 GCTTCTGGAGTGACCAGAGCAGG + Intergenic
902251183 1:15154876-15154898 GCTGCCGGAGTGGGGTGGGCGGG + Intronic
902349909 1:15847067-15847089 GCTGCTGGAGTGCAGTGGCACGG - Intergenic
902440728 1:16428147-16428169 GCTGTTGGAGAGGGGTGAGCAGG + Intronic
902764728 1:18606757-18606779 GCAGCTGGAGTTCCGGGAGTTGG - Intergenic
904743323 1:32695302-32695324 CCAGCTGGAGTGCCGCCAGCAGG - Exonic
905477535 1:38239441-38239463 GCTGGGGGAGTGCCATGTGCTGG - Intergenic
905646129 1:39626193-39626215 GCTGCTGGTGTGCAGAGGGCAGG + Exonic
905960699 1:42040258-42040280 GCTGCTGGAGTGCCAGGAGGAGG + Intergenic
906097759 1:43235777-43235799 GGCTCTGGAGTGCAGTGAGCAGG + Intronic
907439901 1:54472719-54472741 GCTGCTGGGGAGCCATGGGCTGG + Intergenic
908825964 1:68132898-68132920 GCTGCTGGAGCCCCGGGAGGTGG + Intronic
912804075 1:112742220-112742242 GCTGCTGAGGTGGGGTGAGCTGG + Intergenic
914962507 1:152219259-152219281 GCTGGAGGAGTGCCCTGAACTGG + Exonic
922348708 1:224718385-224718407 GTGGCTGGAGTGGAGTGAGCAGG + Intronic
922933110 1:229405318-229405340 GCTGCTAGGATGCCGTGAGAAGG + Intergenic
924727431 1:246683532-246683554 GCTGCTGCGCTGCCATGAGCGGG + Intergenic
1064008641 10:11717517-11717539 GCTGCAGGGGTGGGGTGAGCAGG + Intergenic
1065214446 10:23437307-23437329 GCGGCTGGAGTGACCTGAGCTGG + Intergenic
1067110461 10:43396719-43396741 GCTGCTGGAGTGCCGTGAGCAGG - Exonic
1076681687 10:132175479-132175501 GCTGGTGGGGTCCCTTGAGCCGG + Intronic
1076889335 10:133276276-133276298 GCTCCTGGAGTGACTTGGGCTGG - Intronic
1077451644 11:2651924-2651946 GCTGCAGGAGGGCTGTGAGTAGG - Intronic
1077581598 11:3420819-3420841 GTGGCTGGAGTGGAGTGAGCAGG - Intergenic
1078144308 11:8712640-8712662 GCTGCTGGAGTGGCAGGAGCGGG - Exonic
1079078268 11:17396869-17396891 GCTGCAGGACAGGCGTGAGCAGG - Intronic
1080384492 11:31803124-31803146 GCTGCTGCAGTACAGTGGGCAGG - Intronic
1084238511 11:67803642-67803664 GTGGCTGGAGTGGAGTGAGCAGG - Intergenic
1084833906 11:71789191-71789213 GTGGCTGGAGTGGAGTGAGCAGG + Intronic
1089954468 11:122556951-122556973 GCTGCTGGAGAGCCGGGGCCAGG + Intergenic
1090946048 11:131430704-131430726 CCTGCTGGAGTGCTGTGATAAGG - Intronic
1091058630 11:132441602-132441624 GATGCTGGAGTGCTTAGAGCAGG - Intronic
1091313993 11:134597819-134597841 CCTCCTGGAGTGCTGTGGGCTGG + Intergenic
1091666531 12:2422743-2422765 GCTGCTGGAGTGCTGTGTTGAGG + Intronic
1092409199 12:8241267-8241289 GTGGCTGGAGTGGAGTGAGCAGG - Intergenic
1092833012 12:12463495-12463517 GCTGCTGGACTTCGGAGAGCTGG + Intronic
1094492463 12:30969612-30969634 GCTGCTGGATTGTGGTGATCAGG - Intronic
1094494562 12:30981257-30981279 GCTGCTGGAGGGCCGGGTGCTGG - Intronic
1096148611 12:49295307-49295329 GCTGCTGGAGAAGCGGGAGCTGG - Exonic
1103725336 12:122994928-122994950 GCTGCTGGAATGGCGTGAGCAGG + Exonic
1103921513 12:124401869-124401891 GCTGCAGGAGTGCAGCCAGCTGG - Intronic
1104794352 12:131506855-131506877 GCTGATGGAGTGCAGTGTGGGGG - Intergenic
1104969693 12:132525630-132525652 GGTGCTGGGGTGCCGGGAGCAGG + Intronic
1107446722 13:40475900-40475922 GAGGCTGCAGTGCAGTGAGCTGG - Intergenic
1107656727 13:42599022-42599044 GCTCTGGGAGTGCCGTGTGCAGG - Intronic
1109534082 13:63693761-63693783 GCTGCTGGAGTGCCCTGGCTAGG - Intergenic
1112736970 13:102431152-102431174 GCTTCTGGAGTGCCCTGCTCTGG - Intergenic
1113592626 13:111511958-111511980 CCTGCTGGAATGCCCTGGGCGGG - Intergenic
1113937086 13:114000190-114000212 TCTGCTGGGGTGCCCTGGGCCGG + Intronic
1116866930 14:50038832-50038854 GATGCTGGAGTTGCATGAGCTGG + Intergenic
1117366951 14:55038541-55038563 GCTGCTGGAGTTCTGGGAGCTGG + Intronic
1118951388 14:70439439-70439461 GCTTCTGGAGTGACCAGAGCAGG + Intergenic
1119881465 14:78103271-78103293 GCTCCTGAAGTGCCGTGTGGTGG + Intergenic
1122596841 14:102899599-102899621 GCTGGAGGAGTGCCTGGAGCTGG - Intronic
1124904334 15:33854636-33854658 GGTGCTGAGGTGCTGTGAGCTGG - Intronic
1125143663 15:36440411-36440433 GCTGGTGGAGTACCCTGAGGAGG + Intergenic
1126890146 15:53196407-53196429 GCTGCTGCTGTGCCTTTAGCTGG + Intergenic
1127492658 15:59479728-59479750 GTGGATGGAGTGCTGTGAGCTGG + Intronic
1127793935 15:62422645-62422667 GCTGCTGGAGTGCCAGGAGATGG - Intronic
1128779765 15:70351679-70351701 GTGGCTGGAGGGCAGTGAGCAGG - Intergenic
1129093248 15:73174363-73174385 CCTGCTGGGGTGCTGTGGGCTGG + Intronic
1129137379 15:73566625-73566647 GCTCCTGGAGTGCAGTCCGCAGG + Intronic
1130204009 15:81859230-81859252 GCTGCTGGAGTGCAGTGGTATGG + Intergenic
1130896595 15:88174805-88174827 GCCGCTGGAGGGCTCTGAGCAGG - Intronic
1131071855 15:89471103-89471125 CCTGCTGGAGTGCCCAGAGCAGG + Intergenic
1132151925 15:99468015-99468037 GCAGCTGCAGAGCCCTGAGCTGG + Intergenic
1132869321 16:2108719-2108741 GGTGCTGGCCTGCCGGGAGCCGG - Exonic
1133350168 16:5096070-5096092 GTGGCTGGAGTGGAGTGAGCAGG - Intronic
1134172107 16:11976854-11976876 GCAGCTGGAGCGGCGGGAGCCGG - Intronic
1134718093 16:16366879-16366901 GGTGCTGGCCTGCCGGGAGCCGG + Intergenic
1134956659 16:18385280-18385302 GGTGCTGGCCTGCCGGGAGCCGG - Intergenic
1136374753 16:29858938-29858960 GCTCCTGGGGTGCCGGGACCGGG - Exonic
1136609348 16:31356877-31356899 GCTGCGGGAGTGCGATGGGCGGG - Intronic
1137988594 16:53130897-53130919 GCTGCCGGAGTGCCGCTCGCAGG + Intronic
1138370741 16:56524556-56524578 GCTGCTGGAGTCTCCTGTGCTGG - Intergenic
1138646481 16:58429195-58429217 GCAGCTGGAGGGCAGTGAGCGGG - Intergenic
1139118174 16:63982469-63982491 GCTGCTGCAGAGCAGTGAGCAGG - Intergenic
1142211859 16:88812201-88812223 GCTGGAGGAGGGGCGTGAGCTGG + Intergenic
1142824009 17:2496063-2496085 GCTGCTGGAGTGCAGTGGTGTGG - Intronic
1142904688 17:3034010-3034032 GCTGCCAGTGTACCGTGAGCGGG + Exonic
1144094978 17:11892198-11892220 GCTGCTGGAGTGCTGTGCTGAGG - Intronic
1144178512 17:12731127-12731149 GCTGATGGAGAGCGGTGTGCTGG - Intronic
1144676344 17:17164663-17164685 GCTGCTGGAGAGCTGTGAGAAGG + Intronic
1144689043 17:17247539-17247561 GATGCTGAAGTGCATTGAGCTGG - Exonic
1144778211 17:17795420-17795442 GCTGCTGCAGTGCCCCGAGGTGG + Exonic
1145995698 17:29103631-29103653 GCTGCTGGAGTGCTTGGATCTGG - Exonic
1147260684 17:39208400-39208422 GCTACTGCAGGGCTGTGAGCTGG + Intergenic
1148115253 17:45171592-45171614 GCTGCTGGAGTGTCGGGGGAGGG + Intergenic
1149656299 17:58311129-58311151 GCTGCAGGTGTGTCGTGAGGTGG - Exonic
1150019964 17:61601757-61601779 GTTGCTGGAGCTCAGTGAGCCGG - Intergenic
1152397772 17:80045108-80045130 TCTGCGGAAGTGCCGTGAGACGG + Intronic
1152732015 17:81977242-81977264 GCTGCTGGAGTGGAGGAAGCCGG + Intronic
1154166108 18:12015574-12015596 GCTGCAGGAGAGCCCAGAGCAGG + Intronic
1157508840 18:48253081-48253103 GCTGGAGCAGTGCCCTGAGCTGG + Intronic
1157570713 18:48710282-48710304 GCTGCTGGAGAGCAGTCAGAGGG - Intronic
1160144152 18:76350269-76350291 GCTTCTGGAGAGCAGAGAGCCGG + Intergenic
1160833379 19:1113498-1113520 GCAGCTGGAGTGTGGTGGGCGGG - Intronic
1160969666 19:1761972-1761994 GCTGCTGGAGAGGCGTGCCCGGG + Intronic
1161293190 19:3506578-3506600 GCTCCTGGAGGGGCCTGAGCTGG - Intronic
1162412221 19:10513375-10513397 GATGCTGGTGTGCCTGGAGCAGG - Exonic
1162517214 19:11155668-11155690 GCTGCTGGGGCGCCACGAGCAGG - Exonic
1162559037 19:11405322-11405344 GCAGCTGGGGGGCAGTGAGCCGG - Exonic
1162754878 19:12852020-12852042 GCTGCTGGAGTGCCTGGTGAGGG + Exonic
1162992836 19:14314567-14314589 GCTGCTGCTGTGGCCTGAGCAGG + Intergenic
1163322198 19:16581399-16581421 GGTGCTGGAGTGCCTGGGGCAGG - Intronic
1163435491 19:17292759-17292781 GATGCTGGAATGCCCTGAGACGG - Exonic
1164156983 19:22602983-22603005 GCTGCTGGAGTTGCAGGAGCTGG + Intergenic
1166067734 19:40370015-40370037 TCTGCTGCAGAGCGGTGAGCTGG + Exonic
1166100035 19:40566230-40566252 GCTCCTGCAGAGCCGGGAGCTGG + Exonic
1166295822 19:41888811-41888833 GCTGCAGGAGGGCCATGAGGTGG - Exonic
1167494595 19:49810169-49810191 GCTGCCGGAGGGCTGTGAGCAGG + Intronic
1168408069 19:56121020-56121042 GCTGCTGGGGGGGCGTGAGTGGG - Intronic
925201032 2:1967968-1967990 CCTCCTGGGGTGCAGTGAGCAGG - Intronic
925481252 2:4276883-4276905 GCTGATGCACTGCCGTTAGCAGG + Intergenic
926018465 2:9474589-9474611 GCTGCGGGAGTGCCCTGCTCTGG + Exonic
927637570 2:24827368-24827390 GCTGCAGCAGTGCAGTGAGGAGG - Intronic
928450270 2:31372183-31372205 GCTGGTGGAATGCTGTGAGGGGG - Intronic
930771912 2:55137833-55137855 GCCGCTGGAGTGCTCTGGGCTGG - Intergenic
935265874 2:101393636-101393658 GCTGCTTGAGGACCCTGAGCAGG + Intergenic
935956893 2:108385856-108385878 GCTTCTGAAATGCCTTGAGCAGG + Intronic
936056185 2:109264007-109264029 GCTTCTGGAGTGTCCTGACCAGG - Intronic
938778144 2:134559988-134560010 GTGGCTGGAGTGCAGTGAGCAGG - Intronic
943988935 2:194660905-194660927 GCTGCTGGACTGGCATGTGCAGG - Intergenic
944478435 2:200130139-200130161 GCTGCTGGAGTGAGGTGTGGTGG - Intergenic
944766716 2:202871709-202871731 GCTGCCGGAGGGCCGGGAGTCGG - Intronic
945762401 2:213930067-213930089 GCCGCAGGAGTGCCATGTGCAGG - Exonic
946023698 2:216659206-216659228 GCTGCTGGAGTGCCAGCACCCGG + Intronic
946026063 2:216672674-216672696 ACTGGTGGAGTGGGGTGAGCGGG + Exonic
946063293 2:216964244-216964266 GCTGCTGGAGAGTCGTGAATTGG - Intergenic
948381098 2:237550472-237550494 GCTCCTGGAGAGCCATGTGCTGG + Intronic
948509566 2:238454660-238454682 GCTGCAGGAGGGCCGAGGGCAGG + Intergenic
1168973606 20:1947620-1947642 GCTGATGGAGGGCCTCGAGCTGG + Intergenic
1169191384 20:3660869-3660891 GCGGCGGGAGGGCGGTGAGCCGG + Exonic
1169201051 20:3710399-3710421 GCTGCTGGAGTGGACTGATCTGG + Intergenic
1172027153 20:31956454-31956476 GCTGCTGGAGGGTGCTGAGCAGG + Intergenic
1172108068 20:32528420-32528442 GCTGCTGGAGTGGGGAGGGCAGG - Intronic
1172398716 20:34630366-34630388 GCTGCTGGAGTTGTGAGAGCAGG - Intronic
1172424599 20:34846687-34846709 GCTGTTGGAGGGCTTTGAGCAGG - Intronic
1173310417 20:41892001-41892023 GCTGCGGGAGTCCAGAGAGCAGG - Intergenic
1175247766 20:57591873-57591895 GCTGCTGGGGCGCCGGGAGGGGG + Intergenic
1175822304 20:61916951-61916973 GCTGATGCAGTGCCCTGTGCAGG + Intronic
1176025165 20:62981995-62982017 CCTGCTGGGGGGCAGTGAGCAGG + Intergenic
1176063178 20:63181124-63181146 CCTGCTGGATAGCCCTGAGCTGG - Intergenic
1176088752 20:63309736-63309758 GCTGCTGGAGTAGCGGGAGTGGG - Exonic
1176149962 20:63585737-63585759 CCTTCTGGAGTGCCCTGGGCTGG + Intergenic
1179086823 21:38225723-38225745 GCTTCTGGAGTGACCAGAGCAGG + Intronic
1179965616 21:44802935-44802957 GCAGCTGGAGTGGAGTGAGAGGG - Intergenic
1180837233 22:18936014-18936036 GCTGCTGGCGCGCCACGAGCAGG - Exonic
1180841481 22:18960863-18960885 GCTGCTGGCGCGCCCTGAGCAGG + Intergenic
1181015640 22:20066894-20066916 GCTGCTGGGGAGCCCTGGGCAGG - Intergenic
1181060009 22:20277931-20277953 ACTGCTGGTGCGCCCTGAGCGGG - Intronic
1181064729 22:20300011-20300033 GCTGCTGGCGCGCCACGAGCAGG + Intergenic
1182583968 22:31332553-31332575 GCTTCTGGAGTGCCAAGTGCAGG - Intronic
1183228590 22:36566664-36566686 GCTCCTGCAGGGCTGTGAGCTGG - Intronic
1185172784 22:49303478-49303500 GCTGCTGGACTGAAGTGGGCAGG + Intergenic
1185230232 22:49676274-49676296 GCTGCTCGAGTCTGGTGAGCTGG - Intergenic
1203287326 22_KI270734v1_random:161313-161335 GCTGCTGGCGCGCCACGAGCAGG - Intergenic
957054460 3:75433433-75433455 GTGGCTGGAGTGGAGTGAGCAGG - Intergenic
957255024 3:77825653-77825675 GCTGCTGGAATGCACTGAGGTGG + Intergenic
962303080 3:134260701-134260723 GCTGCTGGAATGCTGTTAGTTGG - Intergenic
963028290 3:140941876-140941898 GCGGCTGGAGTGCCGCGGGGAGG + Exonic
964130545 3:153281550-153281572 GCTGCTGGAGTGCCGGGGCTAGG + Intergenic
965144295 3:164879454-164879476 GCTCCTGTAGTTCAGTGAGCAGG - Intergenic
965538590 3:169850352-169850374 GCTGAGGGAGTGCTGGGAGCAGG - Intronic
966721240 3:183064527-183064549 GCTGGTGGCGTGCCATGAGCAGG - Intronic
967226455 3:187296293-187296315 GCTCCTGGAATGCCATCAGCTGG - Intergenic
967836253 3:193965808-193965830 GCTGAGGGAGTGTCGTGTGCAGG + Intergenic
968066060 3:195760442-195760464 GGGGCTGGAGTGCAGGGAGCTGG + Intronic
968501993 4:955023-955045 CAGGCTGGAGTGCAGTGAGCTGG + Intronic
968560814 4:1280797-1280819 GCAGCTGGGGTGCCGGGAACAGG - Intergenic
968656553 4:1780845-1780867 GCTCCAGCAGCGCCGTGAGCAGG + Intergenic
968997273 4:3953743-3953765 GTGGCTGGAGTGGAGTGAGCAGG - Intergenic
969060745 4:4432391-4432413 GCTGCCCGTGTGCCATGAGCAGG - Intronic
969458329 4:7313778-7313800 GCTGCTGGAGGGTTCTGAGCAGG - Intronic
969756741 4:9154939-9154961 GTGGCTGGAGTGGAGTGAGCAGG + Intergenic
969816711 4:9692508-9692530 GTGGCTGGAGTGGAGTGAGCAGG + Intergenic
969924730 4:10575302-10575324 GCTCCTGAAGTAGCGTGAGCTGG - Intronic
972480185 4:39489304-39489326 GCTTCTGGAGTGACTAGAGCAGG - Intergenic
972613026 4:40672616-40672638 GCGGCTGGAGTGGAGTGAGCCGG + Intergenic
976830033 4:89305338-89305360 GCTGGTGGAGTGCCCTGACAGGG - Intronic
980135610 4:128855861-128855883 CAGGCTGGAGTGCAGTGAGCTGG + Intronic
982400213 4:154958610-154958632 GAAGCAGGAGTGCCATGAGCAGG + Intergenic
992076304 5:73195824-73195846 GCTGCTGCATTTCCTTGAGCAGG - Intergenic
992698838 5:79319056-79319078 GCTGCTGGTGTGCTGTGAATGGG - Intronic
993817182 5:92564577-92564599 ACTGCTTGACTGCAGTGAGCAGG + Intergenic
997745683 5:136298331-136298353 GCAGCTGGAGATCAGTGAGCAGG + Intronic
998040170 5:138946528-138946550 GCTGCTGGAGTGATGGGTGCTGG - Intergenic
999303466 5:150505252-150505274 GCTGGTGGACAGCCGGGAGCAGG - Intronic
1000125707 5:158241785-158241807 GCTGCTGGAGGGTTTTGAGCAGG + Intergenic
1001970255 5:175949627-175949649 TCTGCTGGGGTTCCCTGAGCTGG + Intronic
1001972582 5:175968226-175968248 GCTGCTGCAGTGTTGTGAGTTGG - Exonic
1002123358 5:177022810-177022832 GTTGCTGGAGGGCCAGGAGCCGG + Exonic
1002244859 5:177875555-177875577 GCTGCTGCAGTGTTGTGAGTTGG + Intergenic
1002247183 5:177894137-177894159 TCTGCTGGGGTTCCCTGAGCTGG - Intergenic
1002252608 5:177939059-177939081 GCTGCTGGGGAGCCTGGAGCTGG + Intergenic
1003125460 6:3352074-3352096 GCTGCTGGAGTGCTGAGAGGTGG + Intronic
1003164016 6:3660704-3660726 CTTGCTGGAGTGCCCTGAGGTGG - Intergenic
1003948265 6:11094376-11094398 GCTGATGGTGTGCGGTGAGTGGG + Exonic
1004196820 6:13512731-13512753 GCTGCTGGAGTGCCTGGACTAGG + Intergenic
1005158343 6:22834135-22834157 GCTGCTGCACTGCCTTGAGGAGG + Intergenic
1006749319 6:36366689-36366711 GCCGCTGGAGAGCCAGGAGCAGG - Exonic
1006888184 6:37399837-37399859 CCTGCCGGACTGCCTTGAGCTGG + Intergenic
1007414973 6:41686225-41686247 GCTGCTGCAGGGACGTGCGCTGG - Exonic
1010999158 6:82568393-82568415 GCTGCTGATGTGCCCTCAGCTGG + Intergenic
1015571062 6:134621905-134621927 GCTGCTGGAGCTCCCTGACCAGG - Intergenic
1016120985 6:140340820-140340842 GCTCCTGTAGTTCAGTGAGCTGG + Intergenic
1016381248 6:143483624-143483646 GCTGCTGGAGAGTTTTGAGCAGG + Intronic
1019374004 7:679361-679383 TCTCCTCGTGTGCCGTGAGCAGG + Intronic
1019417243 7:933474-933496 GGTGCTGGAGAGCCGGGGGCCGG + Intronic
1019417254 7:933504-933526 GGTGCTGGAGAGCCGGGGGCCGG + Intronic
1019417270 7:933541-933563 GGTGCTGGAGAGCCGGGGGCCGG + Intronic
1019417301 7:933631-933653 GGTGCTGGAGAGCCGGGGGCCGG + Intronic
1019417312 7:933661-933683 GGTGCTGGAGAGCCGGGGGCCGG + Intronic
1019417323 7:933691-933713 GGTGCTGGAGAGCCGGGGGCCGG + Intronic
1019417354 7:933781-933803 GGTGCTGGAGAGCCGGGGGCCGG + Intronic
1019417395 7:933901-933923 GGTGCTGGAGAGCCGGGGGCCGG + Intronic
1019417416 7:933961-933983 GGTGCTGGAGAGCCGGGGGCCGG + Intronic
1019417427 7:933991-934013 GGTGCTGGAGAGCCGGGGGCCGG + Intronic
1019417455 7:934081-934103 GGTGCTGGAGAGCCGGGAGCCGG + Intronic
1019417466 7:934111-934133 GGTGCTGGAGAGCCGGGGGCCGG + Intronic
1019417487 7:934171-934193 GGTGCTGGAGAGCCGGGGGCCGG + Intronic
1019417498 7:934201-934223 GGTGCTGGAGAGCCGGGGGCCGG + Intronic
1019417526 7:934291-934313 GGTGCTGGAGAGCCGGGAGCCGG + Intronic
1019534558 7:1522053-1522075 GCTGCTGGCGTGGAGTAAGCGGG - Intergenic
1019568627 7:1697365-1697387 GCTGCTGGAGGGGCCTGTGCAGG + Intronic
1019733622 7:2640102-2640124 GCTGCGGGTCTGCCCTGAGCAGG - Intronic
1022814973 7:33905107-33905129 GCTCCGGGAGGGCCGAGAGCCGG + Exonic
1022970936 7:35516594-35516616 CCTGCTGGACTGCCTGGAGCTGG - Intergenic
1024261751 7:47578602-47578624 GCTCCTGGAGTACACTGAGCAGG + Intronic
1025279193 7:57614605-57614627 GGTGCTGGAATGGTGTGAGCTGG + Intergenic
1025305538 7:57850895-57850917 GGTGCTGGAATGGTGTGAGCTGG - Intergenic
1026847033 7:73704139-73704161 GCAGCTGGAGATCAGTGAGCTGG - Exonic
1029640249 7:101815871-101815893 GCTGCGGCGGTGCCGTGAGGAGG + Intergenic
1029710942 7:102299583-102299605 GCTGCTGGAGTGCTGCATGCAGG + Intronic
1033050687 7:138001678-138001700 GGTGCTGGAGAGCGGGGAGCAGG - Exonic
1033653662 7:143360061-143360083 GCTGCTCCCGTGCAGTGAGCTGG + Exonic
1034438723 7:151076033-151076055 GCAGCTGCAGGGCCGTGAACAGG - Exonic
1035215460 7:157363285-157363307 GCTGCTGAAGGACCCTGAGCGGG + Intronic
1036108085 8:5863798-5863820 GCTGCTGGTGTGCTTTGACCAGG + Intergenic
1036377109 8:8210173-8210195 GCAGCTGGAGTGCTGTGCGGAGG - Intergenic
1036849584 8:12192403-12192425 GTGGCTGGAGTGGAGTGAGCAGG - Intronic
1036852439 8:12212976-12212998 GCAGCTGGAGTGCTGTGCGGAGG + Intergenic
1036870946 8:12434676-12434698 GTGGCTGGAGTGGAGTGAGCAGG - Intronic
1036873807 8:12455499-12455521 GCAGCTGGAGTGCTGTGCGGAGG + Intergenic
1039623687 8:39025419-39025441 GCAGCTGCAGGGCAGTGAGCAGG - Intronic
1040537146 8:48320332-48320354 GCTGCTGGAGTACTGTGCACTGG + Intergenic
1042152030 8:65798247-65798269 GCTGCTGGAGTGCAGTGCAGTGG + Intronic
1042155829 8:65842561-65842583 GCTGCGGCAGTGACGTCAGCGGG + Intergenic
1045897261 8:107234385-107234407 GATGCTGGAGGGCTGAGAGCTGG - Intergenic
1048354211 8:133640341-133640363 GCTACTGGAGTGCACTGAGATGG - Intergenic
1048584066 8:135756412-135756434 GCTGCAGAAGTGCCTTGAGTGGG - Intergenic
1048926611 8:139277628-139277650 GGTGCTGGGGTGCCCTGGGCAGG + Intergenic
1049612509 8:143562068-143562090 GCTGCTGGAGGGCCTGGAGGGGG + Exonic
1049724529 8:144139471-144139493 GCAGCTGGATTGCAGGGAGCAGG + Exonic
1049799750 8:144512280-144512302 GCTTGTGGAGTTCAGTGAGCTGG - Exonic
1051792515 9:20823053-20823075 GCTGCTGGAGTAGCTTGATCAGG - Exonic
1055513600 9:77017250-77017272 GTCGCAGGAGTGCCGTGAGCGGG - Intergenic
1060771677 9:126336527-126336549 GGTGCTGCAGTACCGGGAGCTGG + Intronic
1061163320 9:128908562-128908584 GCTCCTTGAGGCCCGTGAGCTGG - Exonic
1061239095 9:129358815-129358837 GCCCCTGCAGGGCCGTGAGCTGG - Intergenic
1061838206 9:133342831-133342853 TCTGCTGCAGGGCCGTGAGCAGG + Intronic
1062282946 9:135760063-135760085 AATGATGGAGTCCCGTGAGCTGG + Intronic
1062710581 9:137973067-137973089 GCTGTTGGTGTGCAGTGAGTCGG + Intronic
1185932559 X:4219245-4219267 ACTGATGGAGTGCCAGGAGCTGG - Intergenic
1187236314 X:17470616-17470638 GTAGCTGGAGTGCAGCGAGCAGG - Intronic
1189352937 X:40290685-40290707 GCTGCTGGGGTCCAGTGACCTGG - Intergenic
1190322273 X:49186247-49186269 GCTCCGGGCGTGCGGTGAGCGGG - Exonic
1190621423 X:52290296-52290318 CCTGCTTGAGTGCCAGGAGCAGG + Intergenic