ID: 1067115464

View in Genome Browser
Species Human (GRCh38)
Location 10:43432468-43432490
Sequence AAAGAACCACAGATGTAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067115464_1067115468 21 Left 1067115464 10:43432468-43432490 CCTGGCTACATCTGTGGTTCTTT No data
Right 1067115468 10:43432512-43432534 GGGGCCTCCCTATGTTGCAATGG No data
1067115464_1067115465 0 Left 1067115464 10:43432468-43432490 CCTGGCTACATCTGTGGTTCTTT No data
Right 1067115465 10:43432491-43432513 TTTTTTTTTTTTTTTTGAGATGG 0: 83672
1: 60776
2: 74199
3: 114646
4: 163091
1067115464_1067115467 2 Left 1067115464 10:43432468-43432490 CCTGGCTACATCTGTGGTTCTTT No data
Right 1067115467 10:43432493-43432515 TTTTTTTTTTTTTTGAGATGGGG 0: 1710
1: 4662
2: 23038
3: 43204
4: 191852
1067115464_1067115466 1 Left 1067115464 10:43432468-43432490 CCTGGCTACATCTGTGGTTCTTT No data
Right 1067115466 10:43432492-43432514 TTTTTTTTTTTTTTTGAGATGGG 0: 2999
1: 17290
2: 21616
3: 48511
4: 122087

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067115464 Original CRISPR AAAGAACCACAGATGTAGCC AGG (reversed) Intergenic
No off target data available for this crispr