ID: 1067116008

View in Genome Browser
Species Human (GRCh38)
Location 10:43436275-43436297
Sequence CAGTTGGAATTAGCAGCCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067116008_1067116011 17 Left 1067116008 10:43436275-43436297 CCTGAGGCTGCTAATTCCAACTG No data
Right 1067116011 10:43436315-43436337 AATACCTCCGCACCCAGGCCTGG No data
1067116008_1067116012 18 Left 1067116008 10:43436275-43436297 CCTGAGGCTGCTAATTCCAACTG No data
Right 1067116012 10:43436316-43436338 ATACCTCCGCACCCAGGCCTGGG No data
1067116008_1067116010 12 Left 1067116008 10:43436275-43436297 CCTGAGGCTGCTAATTCCAACTG No data
Right 1067116010 10:43436310-43436332 TAACAAATACCTCCGCACCCAGG No data
1067116008_1067116015 25 Left 1067116008 10:43436275-43436297 CCTGAGGCTGCTAATTCCAACTG No data
Right 1067116015 10:43436323-43436345 CGCACCCAGGCCTGGGAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067116008 Original CRISPR CAGTTGGAATTAGCAGCCTC AGG (reversed) Intergenic
No off target data available for this crispr