ID: 1067120076

View in Genome Browser
Species Human (GRCh38)
Location 10:43465424-43465446
Sequence TCTCAGATGGGGCAGCTGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 6805
Summary {0: 20, 1: 340, 2: 723, 3: 1614, 4: 4108}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067120070_1067120076 -1 Left 1067120070 10:43465402-43465424 CCGGGCGGAGGGGCTCCTCACTT 0: 1291
1: 4807
2: 5115
3: 7429
4: 7139
Right 1067120076 10:43465424-43465446 TCTCAGATGGGGCAGCTGCCGGG 0: 20
1: 340
2: 723
3: 1614
4: 4108
1067120063_1067120076 24 Left 1067120063 10:43465377-43465399 CCTCACTTCTCAGACGGGGCGGC 0: 1343
1: 2046
2: 5102
3: 9439
4: 6078
Right 1067120076 10:43465424-43465446 TCTCAGATGGGGCAGCTGCCGGG 0: 20
1: 340
2: 723
3: 1614
4: 4108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067120076 Original CRISPR TCTCAGATGGGGCAGCTGCC GGG Intronic
Too many off-targets to display for this crispr