ID: 1067120869

View in Genome Browser
Species Human (GRCh38)
Location 10:43471186-43471208
Sequence TGCAAGGGGTTGAGCGCAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 1, 2: 4, 3: 22, 4: 140}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067120869_1067120877 3 Left 1067120869 10:43471186-43471208 CCCATTGCGCTCAACCCCTTGCA 0: 1
1: 1
2: 4
3: 22
4: 140
Right 1067120877 10:43471212-43471234 TGGAGCACGTGAGTGAGTGCGGG No data
1067120869_1067120881 23 Left 1067120869 10:43471186-43471208 CCCATTGCGCTCAACCCCTTGCA 0: 1
1: 1
2: 4
3: 22
4: 140
Right 1067120881 10:43471232-43471254 GGGATCTGGCTGGCTGCTCCGGG No data
1067120869_1067120876 2 Left 1067120869 10:43471186-43471208 CCCATTGCGCTCAACCCCTTGCA 0: 1
1: 1
2: 4
3: 22
4: 140
Right 1067120876 10:43471211-43471233 ATGGAGCACGTGAGTGAGTGCGG No data
1067120869_1067120880 22 Left 1067120869 10:43471186-43471208 CCCATTGCGCTCAACCCCTTGCA 0: 1
1: 1
2: 4
3: 22
4: 140
Right 1067120880 10:43471231-43471253 CGGGATCTGGCTGGCTGCTCCGG No data
1067120869_1067120882 29 Left 1067120869 10:43471186-43471208 CCCATTGCGCTCAACCCCTTGCA 0: 1
1: 1
2: 4
3: 22
4: 140
Right 1067120882 10:43471238-43471260 TGGCTGGCTGCTCCGGGCACTGG No data
1067120869_1067120878 9 Left 1067120869 10:43471186-43471208 CCCATTGCGCTCAACCCCTTGCA 0: 1
1: 1
2: 4
3: 22
4: 140
Right 1067120878 10:43471218-43471240 ACGTGAGTGAGTGCGGGATCTGG No data
1067120869_1067120879 13 Left 1067120869 10:43471186-43471208 CCCATTGCGCTCAACCCCTTGCA 0: 1
1: 1
2: 4
3: 22
4: 140
Right 1067120879 10:43471222-43471244 GAGTGAGTGCGGGATCTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067120869 Original CRISPR TGCAAGGGGTTGAGCGCAAT GGG (reversed) Intronic
903456448 1:23490513-23490535 ATCAAGGGGTTGGGCACAATGGG + Intergenic
907616028 1:55927395-55927417 CACAAGGGGTTGAGTGCAGTAGG + Intergenic
907616219 1:55929765-55929787 AGCAAGGGGTTGAGCACTGTGGG - Intergenic
908641071 1:66224225-66224247 TGAGAGGGGTTGAGGGGAATGGG - Intronic
911904993 1:103555769-103555791 TTCAAGGGGTTGTGAGAAATGGG + Intronic
913956905 1:143308673-143308695 TGCAAGGGGTTGAGTTTATTAGG + Intergenic
913980536 1:143506979-143507001 TGCAAGGGGTTGAGTTTATTAGG - Intergenic
914074895 1:144333408-144333430 TGCAAGGGGTTGAGTTTATTAGG - Intergenic
914104283 1:144633085-144633107 TGCAAGGGGTTGAGTTTATTAGG + Intergenic
914318069 1:146532563-146532585 TGAAAGGGGTGGAGAGCTATGGG + Intergenic
914496288 1:148200794-148200816 TGAAAGGGGTGGAGAGCTATGGG - Intergenic
918041225 1:180915219-180915241 AGCATGGGGTTGAGCTCAAAGGG - Intronic
922913738 1:229239061-229239083 TGCAAGGGGCTGAGTACAGTGGG - Intergenic
1063537610 10:6900585-6900607 TGCAAGGGGCTGAGTGCAGCAGG - Intergenic
1066781271 10:38948587-38948609 TGCAAGGGGTTGAGTTTATTAGG - Intergenic
1067024030 10:42827812-42827834 TGTCAGGGGATGAGCGCAAGGGG + Intronic
1067120869 10:43471186-43471208 TGCAAGGGGTTGAGCGCAATGGG - Intronic
1068904362 10:62306928-62306950 CGCGAGGGGTTGAGCACAGTAGG - Intergenic
1072589718 10:96818432-96818454 TGCACAGGCTGGAGCGCAATGGG + Intergenic
1073438476 10:103536923-103536945 TGCCTGGGGTTGAGGGCACTGGG - Intronic
1076425660 10:130365838-130365860 TGCAAGGGGAGGAGAGCATTAGG - Intergenic
1081332880 11:41826127-41826149 TGTAAGGGGTAGAACACAATGGG - Intergenic
1087005573 11:93467359-93467381 TGCAAGGAGTTGAGAGCAGCAGG + Intergenic
1087575521 11:99984894-99984916 TGTAAGGGGTTGAGCACAGTGGG - Intronic
1087608359 11:100404991-100405013 TGCGAGGGGTTGAGCACAATGGG - Intergenic
1087618300 11:100514046-100514068 TTCATGGGGTGGAGGGCAATGGG - Intergenic
1087679155 11:101199886-101199908 GGCAAGGGGTGGAGTGCAGTGGG + Intergenic
1093758631 12:22880848-22880870 TGCAAGGGGCTAAGCACAGTGGG - Intergenic
1095191858 12:39266950-39266972 TGCCAGGGCTGGAGTGCAATGGG - Intergenic
1100757878 12:97772657-97772679 TGCAAGGGGTTGAGAGCTGCAGG - Intergenic
1101148940 12:101867035-101867057 CGCAAGGGGTGGAACACAATGGG + Intergenic
1101609642 12:106279049-106279071 TGCAAGGGGCTGAGCGTGGTGGG - Intronic
1102837296 12:116076620-116076642 AGCAAGGGGTCAAGAGCAATTGG + Intronic
1104053665 12:125213080-125213102 TGCCAGGGGTTGAAGGCAGTAGG - Intronic
1104285219 12:127418657-127418679 CTCAAGGGGCTGAGCACAATTGG + Intergenic
1106327721 13:28710192-28710214 TGCAAGGGGTAGAGCAGAATGGG - Intronic
1107217067 13:37934445-37934467 TGTGAGGAGTTGAGAGCAATGGG - Intergenic
1107911047 13:45106235-45106257 TGCAAGGGGTTGAGCGTGGCAGG - Intergenic
1109136323 13:58656262-58656284 TGAAAGGGGTTGAGTGCAGCGGG - Intergenic
1109313886 13:60727273-60727295 CACAAGGGGTTGAGCACAGTGGG - Intergenic
1109693689 13:65926744-65926766 TGCAAGGAGTTGAGAGCGCTAGG - Intergenic
1109705962 13:66092876-66092898 CGCAAGGAGTTGAGAGCAGTGGG + Intergenic
1111104040 13:83622533-83622555 TGCAAGGAGTTCATAGCAATAGG + Intergenic
1111309902 13:86471489-86471511 TGCAAGGGGATGAGTGCAGCAGG - Intergenic
1111485115 13:88887487-88887509 TGCAAAGGGCTGAGCGCAGCAGG + Intergenic
1112902557 13:104376042-104376064 TGAAGGGGGCTGAGCACAATTGG + Intergenic
1117769597 14:59119556-59119578 TGCAAGGGGCTGAGCAAAAGGGG - Intergenic
1119380736 14:74226452-74226474 GGCAAGGCATTGAGAGCAATGGG + Intergenic
1122641770 14:103164203-103164225 CACGAGGGGTTGAGCACAATGGG + Intergenic
1123393835 15:19905942-19905964 TGCAAGGGGTTGAGTTTATTAGG - Intergenic
1126212175 15:46111893-46111915 TGCAAGGGGTGGAGCACAGCAGG + Intergenic
1126984029 15:54282382-54282404 TGCAAGAGGTTGAGCGCAGTGGG - Intronic
1131865583 15:96705184-96705206 TGTAAGGGGTTAAGGGCCATGGG + Intergenic
1131931675 15:97449298-97449320 TGCAAGGGGTTGAACGCAATGGG + Intergenic
1132625178 16:888158-888180 TGCAGGGGGTGGAGCTCAGTGGG + Intronic
1133824101 16:9261739-9261761 CGCACGGGTTTGAGGGCAATGGG - Intergenic
1135479061 16:22805947-22805969 TGGAATGGGTTCAGGGCAATCGG + Intergenic
1136699845 16:32123827-32123849 TGCAAGGGGTTGAGTTTATTAGG - Intergenic
1136767810 16:32803658-32803680 TGCAAGGGGTTGAGTTTATTAGG + Intergenic
1136800339 16:33067039-33067061 TGCAAGGGGTTGAGTTTATTAGG - Intergenic
1136868475 16:33777020-33777042 TGCAAGGGGTTGAGTTTATTAGG - Intergenic
1136958234 16:34810790-34810812 TGCAAGGGGTTGAGTTTATTAGG - Intergenic
1140703255 16:77602038-77602060 CGCAAGGGGCTGAGCGTGATGGG + Intergenic
1141193960 16:81845657-81845679 TGCACTGCGTTGAGCGCAGTGGG + Intronic
1141743818 16:85912817-85912839 TCCAGGGCGTTGAGGGCAATTGG + Intronic
1142301675 16:89262330-89262352 TGCAAGGGGTGGAGCACAGAGGG - Intergenic
1203103704 16_KI270728v1_random:1339048-1339070 TGCAAGGGGTTGAGTTTATTAGG + Intergenic
1203129810 16_KI270728v1_random:1623320-1623342 TGCAAGGGGTTGAGTTTATTAGG - Intergenic
1143201775 17:5118257-5118279 TGCAAGAGGTTGAGCACAGTGGG - Exonic
1145710514 17:26969016-26969038 TGCAAGGGGTTGAGTTTATTAGG - Intergenic
1146319717 17:31837427-31837449 TGCCAGGGGCTGAGGCCAATGGG + Intergenic
1146330127 17:31920042-31920064 TGCATGGGGTGGAGCGGAGTGGG - Intergenic
1146419675 17:32671321-32671343 TGCCAGGGGCTGAGTGCAGTGGG + Intronic
1149644154 17:58227683-58227705 TGCAAGGGGTTGAGCGTGGTGGG - Intronic
1154517307 18:15186423-15186445 TGCAAGGGGTTGAGTTTATTAGG + Intergenic
1159561955 18:70005417-70005439 TGCAAGGGGATTGGCTCAATAGG - Intronic
1159726642 18:71968218-71968240 TGTAAGGGGTTGAGAGCTATTGG + Intergenic
1161274316 19:3407049-3407071 TGCAGGGCCTTGAGCGCCATGGG + Intronic
1165766844 19:38356875-38356897 TGCAAGGGGCTGGGCACAAAGGG + Intronic
926309040 2:11661215-11661237 TCCAAAGAGCTGAGCGCAATAGG + Intronic
926374952 2:12217950-12217972 TGCAAAGGGTTGAGTGCAGTGGG + Intergenic
931567322 2:63628090-63628112 TGCTAGGGGTTGAGAGCTGTGGG + Intronic
933165530 2:79070588-79070610 TGCAAGGGGTTGAGAGCTGTGGG + Intergenic
938517639 2:132031344-132031366 TGCAAGGGGTTGAGTTTATTAGG + Intergenic
939285381 2:140122197-140122219 AGCAAGGGGTTGAGAGCTGTGGG + Intergenic
941358677 2:164524226-164524248 TGCATGGGGCTGAGCTCAAACGG + Intronic
942104100 2:172615120-172615142 CGCAAGGGGTTGAGCACAGCAGG + Intergenic
945868548 2:215202913-215202935 TGCAAGGGGTTGAGAGTTGTGGG - Intergenic
1170897969 20:20433414-20433436 TGCAAGGGGCTGAGGGGATTTGG + Intronic
1174514098 20:51078038-51078060 TGCAGGGGCTGGAGCCCAATGGG - Intergenic
1177384941 21:20396855-20396877 CACAAGGGGCTGAGCGCAGTGGG - Intergenic
1177967280 21:27744091-27744113 TGCAAAGGGTTGAGTGCAGTGGG - Intergenic
1179243668 21:39612420-39612442 TGCAAGGCGTGGGGCGCTATGGG - Exonic
1203288684 22_KI270735v1_random:11637-11659 TGCAAGGGGTTGAGTTTATTAGG + Intergenic
950254398 3:11492760-11492782 CGCAAGGGGTGGAGTGCGATGGG - Intronic
950978980 3:17281005-17281027 CGCAAGGGGTTGAGTGCAACAGG + Intronic
950997551 3:17518997-17519019 TGCAAGGAGTTGAGAGCAGAGGG + Intronic
952881449 3:37988421-37988443 TGCAAGGGGCTGGGGGCAATGGG + Intronic
956010516 3:64826253-64826275 ATCAAGGGGTTGAGGGCAAGGGG - Intergenic
959212865 3:103410527-103410549 TGAAAGGGTTTGAGCGCAGCGGG + Intergenic
959693460 3:109224278-109224300 TGCAAGGGGCTGAGCGTGGTGGG - Intergenic
962007590 3:131363185-131363207 TGCAGAGGGTTGAGCCCACTGGG + Intergenic
963410510 3:144921671-144921693 TGCAAGGGGTGGAACGCAGCAGG - Intergenic
963523068 3:146380619-146380641 TTCAAGGGGTTGAGCATAGTTGG - Intergenic
964903376 3:161688449-161688471 TGCAAGTGTTTTAGCCCAATAGG - Intergenic
974752362 4:66156898-66156920 TGTAAGGGGTTGAACCCAACGGG + Intergenic
975830329 4:78362405-78362427 TACAAGGGGTTGAGCACAGCAGG - Intronic
976041970 4:80897916-80897938 TGCAAGGGGTTGAGTGCCGCAGG - Intronic
977672949 4:99716691-99716713 TGCAAGGAGTTGAGCACAGCGGG + Intergenic
979596691 4:122542197-122542219 CACAAGGGGTTGAGTGCAATGGG + Intergenic
979815157 4:125091903-125091925 TGCAAGGGGTTCAGAGCAGGGGG - Intergenic
980495511 4:133584771-133584793 TGCAAGGGGTTAAGTGCAACAGG + Intergenic
983082152 4:163399803-163399825 TGCAAGGGATGGGGGGCAATGGG + Intergenic
984105481 4:175540746-175540768 TGCAAGGGGTTGAGTGGGGTGGG - Intergenic
986770855 5:10971893-10971915 TGCAAGTGGCTGAGGCCAATAGG - Exonic
987576410 5:19733962-19733984 TGCCAGGGGCTGAGCGCAGTGGG + Intronic
988604744 5:32669485-32669507 TGCAAGAGGTTGAGCACAAGGGG - Intergenic
990293555 5:54379013-54379035 TGCAAGGGGTTGAGCACCATGGG + Intergenic
991548867 5:67814518-67814540 TGAAAGGGCATGAGAGCAATAGG + Intergenic
992206001 5:74430672-74430694 TGCAAAAGGTTGAGCACAGTGGG + Intergenic
993404987 5:87500048-87500070 TGCATGGGGTTGAGGGCCGTGGG + Intergenic
994434107 5:99706473-99706495 TGCAAGGGGTTGAGTACAGCAGG + Intergenic
997039783 5:130238633-130238655 TGAAAGGGGTTGAGAGATATTGG - Intergenic
999924623 5:156361183-156361205 TGCAAGGGGTTGAGCACAGTGGG + Intronic
1000684422 5:164229124-164229146 TGCAAGGGGATGAGCATGATGGG + Intergenic
1002849955 6:985193-985215 TGTAGGGGGTTGAGGGCAAGGGG - Intergenic
1002858423 6:1058299-1058321 TACAAGGGGTTGGGGACAATTGG - Intergenic
1002961949 6:1923548-1923570 CACAAGGGGTTGAGCGCAGCAGG + Intronic
1004564309 6:16781273-16781295 AGAAAGGGGTGGAGAGCAATGGG + Intergenic
1006882074 6:37349093-37349115 TGAAGGGGGTTGAGGGAAATGGG + Intergenic
1010303049 6:74283678-74283700 TGCCAGGGGTTTATCTCAATTGG - Intergenic
1010765953 6:79777563-79777585 TGCAAGAGGTTGAGGGCAGGAGG + Intergenic
1013436282 6:110111760-110111782 TGCTAGGGGTTGAGCTGAAGGGG + Intronic
1014740429 6:125143028-125143050 TGCAAGAGGTTGAGCACCATGGG - Intronic
1018654707 6:166024358-166024380 TGCAAGGGATTGAGCACGGTGGG - Intergenic
1020564489 7:9778475-9778497 TACAAGGGGTTGAGTGCAGCAGG - Intergenic
1021386305 7:20035338-20035360 TGCAAGGGGCTGAGCACAGTGGG - Intergenic
1025482442 7:60999183-60999205 TGCAAGGGGTTGAGTTTATTAGG - Intergenic
1025562562 7:62387017-62387039 TGCAAGGGGTTGAGTTAATTAGG - Intergenic
1025840974 7:65148685-65148707 TGCAAGGGGTTGAGTTTATTAGG - Intergenic
1025877740 7:65501622-65501644 TGCAAGGGGTTGAGTTTATTAGG + Intergenic
1025882074 7:65547268-65547290 TGCAAGGGGTTGAGTTTATTAGG + Intergenic
1025891368 7:65655363-65655385 TGCAAGGGGTTGAGTTTATTAGG - Intergenic
1026918789 7:74139873-74139895 TGCAAGGGGTTGAGCACAGGGGG + Intergenic
1030386091 7:108870209-108870231 CACAATAGGTTGAGCGCAATGGG - Intergenic
1030546810 7:110906924-110906946 TGCAAGTGGTTGAGAGCTGTGGG - Intronic
1031590648 7:123588087-123588109 TGCAAGAGTTTGAGCAGAATTGG + Intronic
1032285395 7:130535518-130535540 TGAAAGGGGTGGACAGCAATGGG + Intronic
1032286180 7:130539917-130539939 TGAAAGGGGTGGACAGCAATGGG + Intronic
1034092927 7:148381022-148381044 TGCAAGGGGTGGAGCACAGTGGG - Intronic
1035812134 8:2501274-2501296 TGCAAGGGGCTGAGCACAGCAGG + Intergenic
1038286093 8:26207463-26207485 TGCAAGGGGCTGAGCACAGCAGG + Intergenic
1045442589 8:102228731-102228753 CTCAAGGGGCTGAGCGCAATGGG + Intronic
1045766741 8:105681318-105681340 TGAAAGGGGTTGTGAGGAATGGG - Intronic
1048800474 8:138189679-138189701 TGTGAGGGGTTGAGCTCAATGGG + Intronic
1050330495 9:4540653-4540675 TGCAAGGGGTGAAGTGCAACGGG + Intronic
1050978052 9:11967171-11967193 TGAGAGGGGTTGAGTGCAAAGGG + Intergenic
1052167872 9:25356209-25356231 TGCAACAGGTTGAGAGCATTAGG - Intergenic
1054855344 9:69893239-69893261 TGCAAGGAGTTGAGAGCTGTGGG + Intronic
1056059635 9:82870621-82870643 AGCAAGGGGTTGAGCGCCACAGG + Intergenic
1056758650 9:89398804-89398826 TGCAAGAGGTTGAGCACAGCAGG + Intronic
1058317547 9:103587006-103587028 TGCAAGGGACTGAGCACAGTGGG + Intergenic
1058588178 9:106532673-106532695 TGCAAGGGGCTGAGTGCAGTGGG - Intergenic
1062672849 9:137721661-137721683 TGCAAGGGGATGAGCGTGAGAGG - Intronic
1187626535 X:21120903-21120925 TGCCAGGGGTTGAGGGTAGTAGG - Intergenic
1188086181 X:25904627-25904649 TGAAAGGGGTACAGGGCAATGGG - Intergenic
1194895141 X:99431479-99431501 TGCAAGGGGAAGAGAGAAATGGG - Intergenic
1197495225 X:127171795-127171817 TGCAAGTGGCTGAGCGCAGCAGG - Intergenic