ID: 1067125551

View in Genome Browser
Species Human (GRCh38)
Location 10:43512508-43512530
Sequence GACAGTTCTTGGCCTATTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067125551_1067125556 16 Left 1067125551 10:43512508-43512530 CCAGTAATAGGCCAAGAACTGTC No data
Right 1067125556 10:43512547-43512569 GTTATCTGCAGAAGATGGCAGGG 0: 180
1: 172
2: 120
3: 86
4: 284
1067125551_1067125554 11 Left 1067125551 10:43512508-43512530 CCAGTAATAGGCCAAGAACTGTC No data
Right 1067125554 10:43512542-43512564 GAGTAGTTATCTGCAGAAGATGG 0: 178
1: 192
2: 102
3: 110
4: 247
1067125551_1067125555 15 Left 1067125551 10:43512508-43512530 CCAGTAATAGGCCAAGAACTGTC No data
Right 1067125555 10:43512546-43512568 AGTTATCTGCAGAAGATGGCAGG 0: 185
1: 187
2: 104
3: 111
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067125551 Original CRISPR GACAGTTCTTGGCCTATTAC TGG (reversed) Intergenic
No off target data available for this crispr