ID: 1067131098

View in Genome Browser
Species Human (GRCh38)
Location 10:43566174-43566196
Sequence TTTCTATTTTCAGCTAATCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 300
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 289}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067131098_1067131103 13 Left 1067131098 10:43566174-43566196 CCAGGATTAGCTGAAAATAGAAA 0: 1
1: 0
2: 1
3: 9
4: 289
Right 1067131103 10:43566210-43566232 GTTACTGAGGGAAGAGAACCAGG No data
1067131098_1067131105 25 Left 1067131098 10:43566174-43566196 CCAGGATTAGCTGAAAATAGAAA 0: 1
1: 0
2: 1
3: 9
4: 289
Right 1067131105 10:43566222-43566244 AGAGAACCAGGGTCCCACTGTGG No data
1067131098_1067131104 14 Left 1067131098 10:43566174-43566196 CCAGGATTAGCTGAAAATAGAAA 0: 1
1: 0
2: 1
3: 9
4: 289
Right 1067131104 10:43566211-43566233 TTACTGAGGGAAGAGAACCAGGG No data
1067131098_1067131100 0 Left 1067131098 10:43566174-43566196 CCAGGATTAGCTGAAAATAGAAA 0: 1
1: 0
2: 1
3: 9
4: 289
Right 1067131100 10:43566197-43566219 CTGAAAGGCCACAGTTACTGAGG No data
1067131098_1067131101 1 Left 1067131098 10:43566174-43566196 CCAGGATTAGCTGAAAATAGAAA 0: 1
1: 0
2: 1
3: 9
4: 289
Right 1067131101 10:43566198-43566220 TGAAAGGCCACAGTTACTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067131098 Original CRISPR TTTCTATTTTCAGCTAATCC TGG (reversed) Intronic
900113437 1:1019303-1019325 TTTCAATCTTCAGCTAGGCCAGG + Intergenic
907009209 1:50947288-50947310 TTTCTCTTTGCAGTTCATCCAGG - Intronic
907808773 1:57847234-57847256 TGTCTGTTTTTAGCTAGTCCTGG - Intronic
908824684 1:68121988-68122010 TTCCTATTTTCAGGTAACCATGG - Intronic
909130697 1:71732905-71732927 TTTCGATTTTCAAATAAACCTGG + Intronic
909253286 1:73385275-73385297 TATTTATTTTCATCCAATCCAGG + Intergenic
911263371 1:95713907-95713929 TTTCTATTTATAATTAATCCGGG + Intergenic
911386090 1:97177451-97177473 TTTCTGTCTTCAGCTACTCAAGG - Intronic
911925397 1:103823884-103823906 TTTCATTTTTCTGCTAATTCTGG - Intergenic
912164597 1:107028334-107028356 TGTATAATTTCAACTAATCCCGG - Intergenic
912241018 1:107908464-107908486 TTTCTTTTTTAAGCTAAAACAGG - Intronic
913670325 1:121092358-121092380 TTTCTTTTTGCAGCTCTTCCAGG + Intronic
914022092 1:143879799-143879821 TTTCTTTTTGCAGCTCTTCCAGG + Intergenic
914452177 1:147802405-147802427 TTACTATTTTCAGCAAAGTCCGG + Intergenic
914660577 1:149787728-149787750 TTTCTTTTTGCAGCTCTTCCAGG + Intronic
914691976 1:150037759-150037781 TTTGTATTTTCAGCTGAGACGGG + Intergenic
914814869 1:151055993-151056015 TTTTTACTTTCTTCTAATCCAGG - Exonic
916079034 1:161220774-161220796 ATTCCATTTTCATTTAATCCAGG + Intergenic
916119486 1:161514958-161514980 TTTCTATGTTCAGATAATATGGG + Intronic
916129250 1:161596615-161596637 TTTCTATGTTCAGATAATATGGG + Intronic
916890650 1:169109165-169109187 TTTATATTTACAGCTAGGCCTGG + Intronic
918823594 1:189292197-189292219 TTTCTATTCTCATCTGATTCAGG + Intergenic
918883149 1:190153525-190153547 TTTCTAGTTTCAGGCACTCCAGG - Intronic
919036465 1:192316410-192316432 TTTATGATTTCAGCTAATCAAGG - Intergenic
922275073 1:224069978-224070000 TTTGTATTCCCAGCTACTCCAGG - Intergenic
922376588 1:224974510-224974532 TTTTTATTTTGAGATAATCGTGG + Intronic
924034087 1:239918480-239918502 TTTCCATTTCAAGCTAACCCAGG - Intergenic
1063341563 10:5270187-5270209 TTTATACTTTGATCTAATCCTGG + Intergenic
1063432900 10:6006445-6006467 TCTCTATTTTAATGTAATCCTGG - Intergenic
1063742839 10:8843055-8843077 TGTGTGTTATCAGCTAATCCAGG + Intergenic
1064289137 10:14017430-14017452 TATATATATTCAGCGAATCCTGG - Intronic
1067131098 10:43566174-43566196 TTTCTATTTTCAGCTAATCCTGG - Intronic
1068154867 10:53185788-53185810 TTTTTATCATCAGCTAATCAAGG - Intergenic
1068922192 10:62496408-62496430 TTTGTATTTTCAGGAAATACGGG - Intronic
1071428751 10:85586171-85586193 TATATATTTACAACTAATCCAGG - Intergenic
1072058158 10:91781509-91781531 TTTGAATTTAGAGCTAATCCTGG - Intergenic
1073384252 10:103109887-103109909 TTTTTATTTTCTGCTATTCTAGG - Intronic
1073938731 10:108668280-108668302 TTTATATTTTTTGCTAATCTGGG - Intergenic
1074123066 10:110507627-110507649 TTTGCATTTTCAGCTAATTTTGG + Intronic
1074866605 10:117547581-117547603 TTTCTATTTTCTGCTGGTCTGGG - Intronic
1075267321 10:121012895-121012917 TATCCCTTTACAGCTAATCCAGG - Intergenic
1078583154 11:12555797-12555819 TTTCTTTTTTCAGCGAATTGAGG - Intergenic
1079207696 11:18431155-18431177 TTTTAAATTTTAGCTAATCCAGG + Intronic
1080254890 11:30279629-30279651 TTTCTATTTCCAGCTGATTATGG + Intergenic
1080894734 11:36439742-36439764 TTTTTGTTCTCAGCTGATCCAGG + Intronic
1080968288 11:37240322-37240344 TTTCTTTGTTCAGCTATTGCTGG + Intergenic
1080981320 11:37410202-37410224 TATCTATTTTGAGTTAATCATGG + Intergenic
1081206045 11:40276891-40276913 TTGCCATTTTCAGCTTCTCCGGG - Intronic
1081490845 11:43567409-43567431 GTTCTGCTTTCAGGTAATCCAGG - Intronic
1082737959 11:56877237-56877259 TTTCTATTTACAGCTGCTCTTGG - Intergenic
1085077982 11:73608967-73608989 TATCAATTTACAGCTAATACAGG - Intergenic
1085978278 11:81688733-81688755 TGTGTATTTTCATCTAATTCTGG - Intergenic
1087691413 11:101325064-101325086 TTTTTTTTTTCAGCTACACCAGG + Intergenic
1088065044 11:105707145-105707167 TTTCTATTGTCATCAAAGCCAGG - Intronic
1088180647 11:107105038-107105060 TTTCTATTTTCTTCTAATTTAGG - Intergenic
1088181064 11:107111816-107111838 TTTCAATTTTCAGCTGGTCAAGG - Intergenic
1090006335 11:123005951-123005973 TTTGTATTTTCAGCAAAGACGGG - Intergenic
1090950517 11:131469051-131469073 TTTATTTTTTCATCTTATCCTGG + Intronic
1091165545 11:133472773-133472795 TAGATATTTTCAGCTAATCTTGG - Intronic
1092029207 12:5269832-5269854 TTTGTATTTTCAGTAAACCCGGG + Intergenic
1093079213 12:14789736-14789758 ATTCCATTTTCAGCTTATACTGG - Intronic
1093599114 12:21000813-21000835 TTTCTATTTTCAGCGGAGGCGGG + Intergenic
1093676672 12:21948782-21948804 TTTCTCTTTTCTGCTAATTGTGG - Intergenic
1095360576 12:41333558-41333580 GTCCAATCTTCAGCTAATCCAGG + Intronic
1095935987 12:47681967-47681989 TTTTTATTCTCACCAAATCCTGG + Intronic
1096360707 12:50983664-50983686 TTTGTATTTTCAGTAAAGCCAGG - Intronic
1096370920 12:51068321-51068343 TTTCTATTTTCAGTAAAGACAGG + Intronic
1096947653 12:55425632-55425654 ATTCTATTTTCAGGTAATACAGG - Intergenic
1097091846 12:56511908-56511930 TTTCTATTGTCACCAAACCCTGG - Intergenic
1098280557 12:68858168-68858190 ATTCTATATAGAGCTAATCCTGG - Intronic
1098297638 12:69020367-69020389 TGACTATTTTCAGCTAAATCAGG - Intergenic
1098524449 12:71470428-71470450 TTTCTATTTACAGGTAATGATGG + Intronic
1099747972 12:86732041-86732063 TTTCTATTTTCAGCCACCACTGG + Intronic
1099962225 12:89407634-89407656 TTTGTAACTTCAGCTAACCCAGG + Intergenic
1100547350 12:95615681-95615703 TTTCTTTTTTCAGCAGGTCCAGG - Intergenic
1100714394 12:97290566-97290588 TTCCTATATACAACTAATCCTGG + Intergenic
1102342388 12:112133501-112133523 TTTCTGTTTTAAAATAATCCTGG + Intronic
1103224131 12:119272269-119272291 TTACTCTTTTCATCTCATCCTGG + Intergenic
1103377354 12:120467921-120467943 TTTCTATGTTCAGCAGATACGGG - Intronic
1104194925 12:126527327-126527349 TTTGCATTCTCTGCTAATCCAGG + Intergenic
1106757128 13:32833294-32833316 TTTCTAATTTCATTTAATCATGG + Intergenic
1107672710 13:42762441-42762463 TTTCAAGTTTCAGCTCATTCTGG - Intergenic
1108128919 13:47275956-47275978 ATTCTATTACCTGCTAATCCAGG + Intergenic
1109136908 13:58662909-58662931 CTTCTGTTTTCAGTTAATCTGGG + Intergenic
1109520390 13:63502787-63502809 TTTGTATTTTCAGCCATTCTTGG - Intergenic
1109949687 13:69484092-69484114 TTTCTATTTTCCTGAAATCCAGG - Intergenic
1109962405 13:69648298-69648320 ATTTTATTTTCAAATAATCCAGG + Intergenic
1111919408 13:94394696-94394718 TTTTTATTTTCAGCTATTTTAGG + Intronic
1112804137 13:103144272-103144294 TTTACATTTTCAGCTAAACGAGG + Intergenic
1115312171 14:31990147-31990169 TTTTTATTTTCACTTCATCCTGG + Intergenic
1116308279 14:43287357-43287379 TTATGATTTTTAGCTAATCCAGG + Intergenic
1116495718 14:45557705-45557727 CTTCTATTTTCATCTTTTCCTGG - Intergenic
1118197848 14:63644633-63644655 TTTCTATTTTCAGCAGACACTGG + Intergenic
1118850521 14:69579612-69579634 GTTCTAATTTCAGCTCCTCCAGG + Intergenic
1118988443 14:70777000-70777022 TTTCTATTTTCAGCAGAGACAGG + Intronic
1119563647 14:75610408-75610430 TTTATTTTTTTAGCTAAGCCCGG - Intronic
1120279643 14:82422640-82422662 TTTCTATGTTTAGCAAAACCTGG - Intergenic
1120835349 14:89034195-89034217 TTTCTCTTTTCATCATATCCTGG + Intergenic
1123175879 14:106418208-106418230 GTTCTTTTTTCAGTGAATCCAGG + Intergenic
1124398986 15:29332006-29332028 TGTTTATATTCAGTTAATCCTGG - Intronic
1124822060 15:33056016-33056038 TTTCTAATTTGAGCTCATTCTGG - Intronic
1125700391 15:41677579-41677601 GTTCTAATTTCTGCTTATCCTGG + Intronic
1127397660 15:58555649-58555671 TTGCTTTCTTCAGCTGATCCAGG - Intronic
1129049616 15:72769516-72769538 TTTGTATTTTTAGCTAAGACAGG + Intronic
1131676000 15:94671350-94671372 TTTCTATTTTCAGTAAATTAGGG - Intergenic
1132269253 15:100508812-100508834 TTTCTCTCTTCAGCTACTCAAGG + Intronic
1133009570 16:2903553-2903575 TTTTTATTTTCAGAAAATCAAGG + Intergenic
1134107697 16:11495550-11495572 TTTCTATTTTTAGTAAAGCCGGG + Intronic
1135611065 16:23867594-23867616 TGTCTATTTTCATCAAGTCCTGG + Intronic
1137019562 16:35410755-35410777 TTTTTATTTTCAGGTAATTGTGG - Intergenic
1138444038 16:57052147-57052169 TTTCTAATTTCAGCTCAGACTGG + Intronic
1141685327 16:85566791-85566813 TTTCTCTTGTCAGATAATCACGG - Intergenic
1143698719 17:8640865-8640887 TATCTATTTTCAACAAACCCAGG - Intergenic
1146042867 17:29473462-29473484 TTTCTATTTTCAGCAGAGACGGG - Intronic
1150203930 17:63386284-63386306 TTCCTTTTTTTAGCTAATCAAGG + Intronic
1154249715 18:12734319-12734341 TTTGTATTTTCAGTAAATACAGG - Intergenic
1155873883 18:31061118-31061140 TCTCTATTTTCAGCAACACCAGG + Exonic
1156184652 18:34647777-34647799 TTACAATTTTCAGCTAATATAGG + Intronic
1158529857 18:58250064-58250086 ATACTTTTTTCAGCTAATCTTGG + Intronic
1158669409 18:59461471-59461493 TTTCTACTTTCAAATATTCCTGG + Intronic
1158963753 18:62606510-62606532 TTTCTCTTTTCATTTAATGCTGG + Intergenic
1158978022 18:62730117-62730139 TTTCCATATTCAGCAAATCAAGG - Intronic
1159085511 18:63785267-63785289 TTTCTATTTTAAATGAATCCCGG + Intronic
1159653940 18:71009535-71009557 ATTAGATTTTCAGCTTATCCAGG + Intergenic
1159687417 18:71439876-71439898 TTTATATTTTTAGCTAGTTCTGG - Intergenic
1160671005 19:363362-363384 TTTCTATTTTCAGCAGAGACGGG + Intronic
1162915066 19:13870250-13870272 TTTCTATTTTTAGTTGAGCCAGG + Intronic
1165689103 19:37849288-37849310 TTTCCTTTTTCAGCAAATCTTGG - Intergenic
1166241262 19:41496066-41496088 TTTCTATTTCCTGTTAATGCAGG + Intergenic
1167864847 19:52316399-52316421 TTTGTATTTTCAGTTAAGACAGG + Intronic
925431938 2:3802198-3802220 CTTCTATCTTTAGCCAATCCTGG + Intronic
927143891 2:20148054-20148076 TGTCTATTAACAGCTAGTCCTGG - Intergenic
927601405 2:24445148-24445170 TTTCTTTCTTCAGGTACTCCAGG + Intergenic
928087010 2:28352292-28352314 CTTCTATTTTAAGCTCCTCCCGG - Intergenic
928600051 2:32895679-32895701 TTTCTATACTTAGCTCATCCTGG - Intergenic
928906328 2:36371949-36371971 TCTGAATTCTCAGCTAATCCAGG + Intronic
938495296 2:131794636-131794658 TTGGTGTTTTCAGCTAATCTTGG - Intergenic
939425641 2:142032765-142032787 TCTCTGTTTTCAGCTAAACATGG + Intronic
939782347 2:146464888-146464910 CTTCTATTCTCATCCAATCCTGG + Intergenic
939828391 2:147043623-147043645 GTTCTATTCTCAGCTAATGCAGG - Intergenic
940373412 2:152926307-152926329 TTTCCAGTTTCTGATAATCCTGG + Intergenic
940568086 2:155394605-155394627 TTTCTCCTTTCAGCAAATCTGGG + Intergenic
942693457 2:178612153-178612175 ATTTTATTTTCAGCCACTCCTGG - Exonic
942731924 2:179069717-179069739 TTGCCATTTTCACTTAATCCAGG - Intergenic
942787636 2:179718710-179718732 TTTCTATTTTCAGCCAAATGTGG + Intronic
942867107 2:180690175-180690197 CTACTATCTCCAGCTAATCCAGG - Intergenic
943042268 2:182817731-182817753 TTTCTATTTTTAGTTAGTCAAGG - Intergenic
943404861 2:187468940-187468962 GTTCTATTTTCTGCTAATATTGG - Intronic
943875235 2:193059006-193059028 TTTCTAGTTTCATATAATCATGG + Intergenic
944241527 2:197490237-197490259 TTTCTATTGTCACCAAACCCTGG + Exonic
944695020 2:202193011-202193033 TTCATTATTTCAGCTAATCCTGG + Intronic
945598021 2:211819491-211819513 TTTCTATTTTCTGCAAATTCTGG - Intronic
945682946 2:212935555-212935577 TTGGTATTTTCAGCTGATGCTGG + Intergenic
945846911 2:214956201-214956223 TTTCTATCTTAAGCTAATACAGG - Intronic
945943369 2:215971656-215971678 TTTCTACATTCAGCTTGTCCAGG - Intronic
946268950 2:218573144-218573166 TTTCTATTTTTAGCAAAGACGGG - Intronic
1170665169 20:18380399-18380421 TTTCTATTTTTAGCTCTTTCAGG + Intergenic
1170755695 20:19204740-19204762 TTTTTATTTTGAGCTAATTTTGG - Intergenic
1172417740 20:34784907-34784929 TTTCTATTTTCAGTAAAGACGGG - Intronic
1174234584 20:49079062-49079084 TTTGTATTTTCAGTAGATCCGGG + Intronic
1175710841 20:61219510-61219532 TTTTTCTTTTCTGTTAATCCTGG - Intergenic
1177728544 21:24997985-24998007 TTTCTATCTCCAGATGATCCTGG - Intergenic
1178064393 21:28888067-28888089 TTTCTATTGTCACCAAACCCTGG + Intergenic
1178937117 21:36872999-36873021 TTTTCATTTTCAGCTGATCTGGG + Intronic
949584651 3:5425745-5425767 CTTGTGTTTTCAGCTCATCCTGG - Intergenic
949620103 3:5801164-5801186 TTTCTAGTGTCAGCGAATTCTGG + Intergenic
950739528 3:15039109-15039131 TTTCTGTTTTCAGATCATCCAGG + Exonic
952574324 3:34756408-34756430 TTTCTATATTTAGCCAATCATGG + Intergenic
952648636 3:35694695-35694717 TTGCAATTTTTAGCCAATCCAGG - Intronic
953097035 3:39788094-39788116 TTTCTGTTTTCCGCTAAGTCTGG - Intergenic
953608273 3:44426138-44426160 TTTGTATTTTTAGCTAAGACAGG + Intergenic
954203171 3:49037558-49037580 TTTGTATTTTCAGTTGATACGGG - Intronic
954499126 3:50993448-50993470 TTTCTATTTCCAGTCATTCCAGG - Intronic
955801741 3:62693825-62693847 TTTTTATTGTTAGCTCATCCTGG - Intronic
955910626 3:63856174-63856196 TTTCAATTTTTAGCTTATCATGG - Intronic
956824148 3:72982030-72982052 TTTCTATATTCAGATAAACTTGG + Intronic
957152178 3:76500011-76500033 TTTGTTTTTTCATTTAATCCAGG + Intronic
957710687 3:83855167-83855189 TTGCCATTTTTAGCTAATGCAGG - Intergenic
959403346 3:105930004-105930026 CTTCTATTTTCAGCTCAAACTGG - Intergenic
960025187 3:113000925-113000947 TTTGAATCTTCAGCTAAACCGGG - Exonic
960438874 3:117662126-117662148 TTTCTTTTTACTGCTAATGCTGG + Intergenic
961052678 3:123760347-123760369 TTTGTATTTTTAGTTAAGCCAGG + Intronic
964987674 3:162764660-162764682 TTTCTCTTTGAAGCTATTCCAGG - Intergenic
967659207 3:192084904-192084926 CTGCTACTTTCAGCTAATACTGG + Intergenic
967897561 3:194410705-194410727 TGCCTACTTTCAGCTAAACCGGG + Intronic
968236912 3:197037429-197037451 TTTCTACTTGTAGCTAATCATGG - Intergenic
970174009 4:13319524-13319546 TTTCTATTTTCATTTATTTCAGG + Intergenic
970958487 4:21843734-21843756 TTTCTCTTTCCAGCTATTTCTGG - Intronic
970961492 4:21876968-21876990 TTTTTTTTTTCTCCTAATCCAGG - Intronic
973780845 4:54287100-54287122 TTCCTATTTTTAGATATTCCTGG - Intronic
973991950 4:56418008-56418030 TTTGTATTTTCAGTAAATACAGG + Intronic
974822068 4:67080123-67080145 TTTTTTTTTTCAACAAATCCAGG + Intergenic
975084381 4:70320005-70320027 TTTCTATTTTCATCTACTAGGGG - Intergenic
975350586 4:73341448-73341470 TTTCTATTCTATGCTACTCCTGG + Intergenic
975869426 4:78762295-78762317 TTTTTATTTTCTGCTCTTCCTGG + Intergenic
976389141 4:84492130-84492152 TTTCTTTTTACAGCTAATAATGG - Exonic
977733828 4:100387103-100387125 TTTCTGTTTTCAGTTCTTCCAGG + Intergenic
978984685 4:114997081-114997103 CTCCTATTTTCCGCTTATCCAGG + Intronic
979191996 4:117873011-117873033 CTACTATTTTTACCTAATCCTGG + Intergenic
979791101 4:124782074-124782096 CTTCTACCTTCAGCTATTCCTGG + Intergenic
980271137 4:130584917-130584939 ATTCTAATTTCAGGTAATCTTGG + Intergenic
980870939 4:138610004-138610026 TTTCTATTTTCAGCTTACCCAGG - Intergenic
981349244 4:143709856-143709878 TTTCTGATTTAAACTAATCCAGG + Intergenic
981446606 4:144846533-144846555 TTTCTATTGTCACCAAACCCTGG - Intergenic
982312045 4:153996661-153996683 TTTCTTTTTTCAGGTAAATCAGG + Intergenic
984416167 4:179460377-179460399 TTTCTATTTTCTGATTATGCTGG - Intergenic
986512478 5:8522979-8523001 TTTCTATGCTCAGCTACCCCAGG - Intergenic
986931643 5:12831935-12831957 TTGCTTTTATCATCTAATCCTGG + Intergenic
987739177 5:21883497-21883519 TTTCTATTGTCACCAAACCCTGG - Intronic
988454887 5:31378687-31378709 TTCCTACTTTCACCTATTCCTGG + Intergenic
989057952 5:37382839-37382861 TTTCTATTTTCAGTCAAGACGGG - Intronic
989388823 5:40879530-40879552 TATATATTTTCAGATAATCTGGG + Intergenic
990001526 5:50898848-50898870 TTTCTATTTCAAGCTCATTCAGG - Intergenic
990460297 5:56025381-56025403 TTTATATTTTAACCTACTCCAGG + Intergenic
990787219 5:59435198-59435220 TTTCCATTTTAAGATAATCTTGG - Intronic
990797699 5:59563290-59563312 TTTCAAATTTCAGTTAACCCAGG + Intronic
993626966 5:90237635-90237657 TTACTACTTTCAGCTAAGGCTGG + Intergenic
994628249 5:102249188-102249210 TTTTTTTTTTCAGCTAAACATGG + Intronic
994768067 5:103946267-103946289 TTTCTATTTTCAGTTTAGACGGG + Intergenic
994846100 5:104990377-104990399 TTTGTGTTTTCAGCTAACCAGGG + Intergenic
995077231 5:108000301-108000323 TTTCTATTTTCACCTTGGCCTGG - Intronic
995938283 5:117546086-117546108 TTCCTATTTTCAGTTCATCATGG + Intergenic
996012068 5:118492208-118492230 TCTCTGTTTTCAGCATATCCTGG - Intergenic
997815382 5:137012004-137012026 TTTCTTTTTTCATTTAATCCTGG + Intronic
1001073424 5:168606197-168606219 TTTCTATTCGCAGCTATACCAGG + Intergenic
1002364876 5:178702071-178702093 TTTTTTTTTTTAGTTAATCCAGG - Intergenic
1003699883 6:8451043-8451065 TTTCTGTTTATAGCTAATACTGG + Intergenic
1003751195 6:9058639-9058661 TGTATATTTTTGGCTAATCCAGG - Intergenic
1004075730 6:12342640-12342662 TTTCCATTTTCCGCTCATTCAGG + Intergenic
1004914074 6:20315282-20315304 TGTCTATTCTCTGCTAATCTGGG + Intergenic
1005246739 6:23894606-23894628 TATCTATATTAAGCTAAACCTGG + Intergenic
1006044527 6:31283500-31283522 TTTCTAGTTTCAGCATGTCCTGG - Intronic
1006053574 6:31363299-31363321 TTTCTAGTTTCAGCAGGTCCTGG - Intergenic
1007871261 6:45041636-45041658 TTTGCATTTTCAGCTGCTCCTGG - Intronic
1008159802 6:48063166-48063188 AATCTACTTTTAGCTAATCCTGG + Intronic
1008852032 6:56034038-56034060 TCTCAATCTTAAGCTAATCCTGG - Intergenic
1009022225 6:57957857-57957879 TTTCTATTTTCAGTCAAGACGGG + Intergenic
1010040059 6:71370674-71370696 TTTCTATAGTCAGGTAACCCAGG - Intergenic
1010645278 6:78380303-78380325 TTTCTGTTTTTAGCTACCCCTGG - Intergenic
1011887857 6:92119959-92119981 TTTCTATTTTCATCTTCTCATGG + Intergenic
1013244170 6:108271064-108271086 TTTCTATTTTTAGCTCTTTCAGG - Intergenic
1013429172 6:110040648-110040670 TTTGTATTTTTAGCAAATACGGG + Intergenic
1014599892 6:123398176-123398198 TTTCTATTTTCAGTAAAGTCAGG + Intronic
1015129939 6:129797626-129797648 TTTTTATTTTCAGAGAAACCTGG + Intergenic
1015302125 6:131665744-131665766 TTTCTTTTTTCTGCTAAACTTGG + Intronic
1015486299 6:133773853-133773875 TTTCTATTTTCTGTTACTGCAGG - Intergenic
1015951354 6:138556480-138556502 TCTCTATTTTCAATTAATTCAGG + Intronic
1016145997 6:140674682-140674704 TTTCTTTTTTTAGTTAATACGGG + Intergenic
1016396105 6:143624982-143625004 TTTCTATTTTCAGTAGATACGGG - Intronic
1020761960 7:12278673-12278695 TTTCAGCTCTCAGCTAATCCTGG + Intergenic
1020876971 7:13709669-13709691 TTTCTATTTTCTTCTAAACAGGG + Intergenic
1020879197 7:13737858-13737880 TTTCTGTTTTCTGCTATTTCAGG - Intergenic
1021229701 7:18071171-18071193 TTTTTATTTTCATGTAATTCAGG - Intergenic
1021825678 7:24548632-24548654 TTTCTATTTTCAAGTTATCTAGG + Intergenic
1023713249 7:43016873-43016895 CTTCTATTTTCAGCTGTTTCTGG - Intergenic
1024845776 7:53640455-53640477 TTTTTATTTTCTGATAATTCAGG + Intergenic
1025120508 7:56297717-56297739 TTTCTATATTCAGCTTTTCAGGG - Intergenic
1025709588 7:63894956-63894978 TTTTTATTTTCAGATACTACTGG - Intergenic
1026376932 7:69761230-69761252 TCTCTTTATCCAGCTAATCCAGG - Intronic
1027536684 7:79411975-79411997 TTTATACTTTCAGTTAATCAGGG + Intronic
1027956838 7:84889183-84889205 TTTCTATTTAAAGTGAATCCAGG + Intergenic
1028683537 7:93566802-93566824 TTTCTATTTTTAGTTATACCTGG + Intronic
1032187916 7:129743436-129743458 TTTCCATTTTCAGCAACTCTTGG + Intronic
1032733923 7:134672587-134672609 TTTCCCTTTTCAGCCAACCCTGG + Intronic
1032935486 7:136725948-136725970 TTTCTTGTTTCAGTTAATACAGG - Intergenic
1033603464 7:142907593-142907615 TTTCTATTTTCAGATACTTTGGG - Intergenic
1034019304 7:147624702-147624724 GTTCTATTTTCAGCTTCTCAAGG - Intronic
1036283300 8:7419752-7419774 TTTCTATTGTCACCAAACCCTGG - Intergenic
1036338170 8:7891769-7891791 TTTCTATTGTCACCAAACCCTGG + Intergenic
1039194527 8:35016091-35016113 TTTCTATTTTTAGCTTTTACAGG - Intergenic
1042332962 8:67601028-67601050 TTTCCATTTTCAGCAATTACAGG - Intronic
1042521206 8:69712877-69712899 TTTCCATTTTCAATTATTCCTGG + Intronic
1044397496 8:91730263-91730285 TTTATATTTTCTGCTTCTCCTGG - Intergenic
1048150608 8:131889919-131889941 TTTGTATTTCCAGCTTATCATGG + Intergenic
1049068158 8:140335876-140335898 TTTGTATTTTCAGTAGATCCAGG + Intronic
1050662786 9:7901629-7901651 TCTCAATTTTTAGCTCATCCAGG - Intergenic
1050818125 9:9840896-9840918 TTTTTATATTCAGCAGATCCTGG + Intronic
1052263652 9:26546954-26546976 TCTCTATATTCAGCTTCTCCAGG - Intergenic
1052318103 9:27137411-27137433 TTTCTTTTTTCAGCTATTTTAGG + Intronic
1053181385 9:35973779-35973801 TTTCTATTTTCATTTATTTCAGG + Intergenic
1053257389 9:36629169-36629191 TTTGTATTTTCATTTAATCTGGG + Intronic
1055104069 9:72494239-72494261 TTTCAATTTAAGGCTAATCCTGG + Intergenic
1055716057 9:79119603-79119625 GTTCTATTTTTAGCTTATCATGG + Intergenic
1058772569 9:108250343-108250365 ATTCTATTTTCAGTTAATAAAGG + Intergenic
1058876112 9:109246325-109246347 TCTCTATTTTTAAATAATCCTGG - Intronic
1059030407 9:110687504-110687526 TTTCTATTTTCAGAATATACAGG + Intronic
1059936683 9:119318914-119318936 TTCCAAATTTCAGCTAATTCTGG - Intronic
1060911461 9:127354468-127354490 TTTTTATTTTCAGTAAAACCTGG - Intronic
1188530182 X:31131881-31131903 TTGCTACTTTCAGCTAACTCAGG - Intronic
1188997995 X:36909661-36909683 TTTCTTTTTGCAGGTAATGCAGG - Intergenic
1189771339 X:44430749-44430771 TTTCCATCCTCAGCTCATCCTGG + Intergenic
1190228704 X:48564840-48564862 TTTCTATTTTCAGTAGATACGGG - Intergenic
1190904023 X:54708374-54708396 TTTCTAATTTCAGCAATTCCAGG + Intergenic
1190991944 X:55560888-55560910 TTTCTATTTTATGGAAATCCAGG - Intergenic
1193978054 X:88147918-88147940 TCTCAATTTTCAGGAAATCCTGG - Intergenic
1194105154 X:89759582-89759604 TCTCTCTTTTCTCCTAATCCAGG - Intergenic
1194767896 X:97863853-97863875 TTTCTATTATAAGCAAATCCTGG + Intergenic
1199229115 X:145414711-145414733 TTTCCATTTTTAAATAATCCAGG + Intergenic
1200316906 X:155143784-155143806 ATTCTATTTTAAGCTAATTCTGG - Intronic
1200457115 Y:3407399-3407421 TCTCTCTTTTCTCCTAATCCAGG - Intergenic