ID: 1067131291

View in Genome Browser
Species Human (GRCh38)
Location 10:43567826-43567848
Sequence TTTTGTGTCAAAAAGGAAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 441
Summary {0: 1, 1: 0, 2: 8, 3: 48, 4: 384}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067131288_1067131291 16 Left 1067131288 10:43567787-43567809 CCAAGTTCTTTAGCTGCTTAGAA 0: 1
1: 0
2: 0
3: 12
4: 177
Right 1067131291 10:43567826-43567848 TTTTGTGTCAAAAAGGAAGTAGG 0: 1
1: 0
2: 8
3: 48
4: 384
1067131287_1067131291 26 Left 1067131287 10:43567777-43567799 CCAATTTTTACCAAGTTCTTTAG 0: 1
1: 0
2: 2
3: 25
4: 283
Right 1067131291 10:43567826-43567848 TTTTGTGTCAAAAAGGAAGTAGG 0: 1
1: 0
2: 8
3: 48
4: 384

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067131291 Original CRISPR TTTTGTGTCAAAAAGGAAGT AGG Intronic
900802663 1:4747057-4747079 TTTTGTGTCAACATGGAGGCTGG - Intronic
901653754 1:10757480-10757502 GTTTGTTTTAAAAAGGTAGTTGG - Intronic
902660643 1:17899965-17899987 TTTTCTGTGAAAAATGATGTTGG - Intergenic
902695779 1:18139926-18139948 TTTTTTAAAAAAAAGGAAGTTGG - Intronic
905970029 1:42134861-42134883 TTTGGTGGCAAAAAAGAAGTGGG - Intergenic
906028961 1:42701414-42701436 CATTATTTCAAAAAGGAAGTGGG + Intronic
906625806 1:47324540-47324562 TTAAGTGTCTAAAAGGAATTTGG - Intergenic
906806679 1:48785867-48785889 TATTGTCTCAAAAATGATGTTGG - Intronic
907390306 1:54153753-54153775 CTTTGTGTCCAACAGGAAGCGGG + Exonic
909165620 1:72220430-72220452 CTTTGTGCCAGAAAGGAAGAGGG - Intronic
909249507 1:73333906-73333928 TTTTGTTTTAAACAGAAAGTTGG - Intergenic
911757911 1:101581953-101581975 CTTTTTGTCAAAAGGGGAGTTGG - Intergenic
911908113 1:103595036-103595058 TTTTGTGTTTAAAAGGCAATGGG - Intergenic
911913647 1:103667517-103667539 TTTTGTGTTTAAAAGGCAATGGG - Intronic
911914805 1:103684430-103684452 TTTTGTGTTTAAAAGGCAATGGG + Intronic
911996007 1:104767627-104767649 TTTTGTTTCAAAAAGTAAAATGG - Intergenic
912709920 1:111942889-111942911 TTTTGTGTCAGAAAGAAGGCCGG - Intronic
913568882 1:120100789-120100811 TTTCATCTCAAAGAGGAAGTTGG - Intergenic
914289691 1:146261780-146261802 TTTCATCTCAAAGAGGAAGTTGG - Intergenic
914550735 1:148712563-148712585 TTTCATCTCAAAGAGGAAGTTGG - Intergenic
914696119 1:150081865-150081887 TATTCTGTGAAAAAGAAAGTTGG - Exonic
914804754 1:150983828-150983850 TTTTGAGATAAAATGGAAGTGGG + Intronic
916150036 1:161778674-161778696 TTTGCTTTTAAAAAGGAAGTTGG + Intronic
916856379 1:168754539-168754561 TTTTAAGTTAAAAAAGAAGTAGG - Intergenic
917499910 1:175576749-175576771 TAGTGTCTCAAAAATGAAGTAGG - Intronic
919643858 1:200072545-200072567 TTTTTAGTTAATAAGGAAGTGGG + Intronic
920628629 1:207629175-207629197 TTTTGTGTAGAAATGGGAGTGGG - Intronic
920825402 1:209420466-209420488 TTTTGTAACAAAAATGAAATGGG - Intergenic
922065624 1:222136893-222136915 TATTGTGACCTAAAGGAAGTCGG + Intergenic
923036436 1:230288027-230288049 ATTTTTGGCAACAAGGAAGTTGG + Intergenic
923523825 1:234757315-234757337 TTTGGTGTATAAAAGGAAGAAGG + Intergenic
923852403 1:237811520-237811542 TTTTTTATTAAAAAGAAAGTTGG - Intronic
923907896 1:238406112-238406134 ATTTGTGTCAAAAAAGAACAGGG - Intergenic
924070991 1:240278449-240278471 TTCTGTGCCAAAGAGGAATTTGG + Intronic
924079780 1:240382735-240382757 TTTTCTGTGAAAAATGATGTCGG - Intronic
924184122 1:241469275-241469297 TTTTGAGTCAAACAGGAATTAGG + Intergenic
924302021 1:242649560-242649582 TTTTGTTTTAAATAGGTAGTGGG + Intergenic
924657945 1:245990438-245990460 CTGTGTGACCAAAAGGAAGTAGG - Intronic
924791954 1:247259484-247259506 CTTTGAGTCAAAAGAGAAGTTGG - Intergenic
1062970057 10:1640478-1640500 TTTTATGTCAAAATGTAAATGGG - Intronic
1063965846 10:11345069-11345091 TCTAGTGTAAAACAGGAAGTAGG - Intergenic
1064457431 10:15501156-15501178 TGGTGTGTCAAAATGCAAGTTGG - Intergenic
1066227857 10:33402010-33402032 TTTTGTTTAAAAAAATAAGTAGG - Intergenic
1066428780 10:35333460-35333482 TTTTCTGTCCTAAAGGAAGCTGG - Intronic
1066708769 10:38209673-38209695 ATTTGTTTCAAAAAAGAATTTGG + Intergenic
1066980730 10:42412820-42412842 ATTTGTTTCAAAAAAGAATTTGG - Intergenic
1067033213 10:42894259-42894281 TTTTGCGTCAAAGAGTAAATTGG + Intergenic
1067054944 10:43044957-43044979 TTGTGTGCCAGAAAGGCAGTGGG + Intergenic
1067131291 10:43567826-43567848 TTTTGTGTCAAAAAGGAAGTAGG + Intronic
1068546289 10:58349396-58349418 TTTTGTCTCAAAGGGGAAGAAGG + Intronic
1070200781 10:74203836-74203858 ATTTCTGTAAAAAAGGCAGTTGG + Intronic
1071224927 10:83518133-83518155 TTATGTCTCAAAATGGAACTTGG + Intergenic
1071791899 10:88963739-88963761 TTTTGGGTCAAAAAAGAAGTAGG + Intronic
1071875938 10:89843343-89843365 TTTTCTGTGAAAAATGACGTTGG + Intergenic
1072308010 10:94126621-94126643 TTTTGTTTCAAAAAAGATATTGG + Intronic
1072446215 10:95500986-95501008 TTTTGTGTCCTTAAGGAAGGCGG - Intronic
1073199036 10:101719788-101719810 TTGTTTGGCAAAAAGGAAATAGG - Intergenic
1073961959 10:108942242-108942264 ATTTGTGTCTAAAAGCAAGGCGG - Intergenic
1074416321 10:113270011-113270033 TTTTTTTTAAAAAAGGAAGTTGG + Intergenic
1074657668 10:115612802-115612824 ATTTGTGTCAAAAATTAAGCTGG - Intronic
1074725991 10:116310529-116310551 GTTTGTGTGAAAAAGAAAGTTGG - Intergenic
1074775400 10:116764505-116764527 TTTTGTGTTAAAAAGGAGTGGGG + Intergenic
1076168510 10:128301482-128301504 GTTTGTGACAAGAGGGAAGTAGG - Intergenic
1076255873 10:129024380-129024402 TGTTGTTTCAACAAGGAAATGGG + Intergenic
1078389465 11:10924347-10924369 TTATGTGACAGAAAAGAAGTAGG - Intergenic
1078614050 11:12848236-12848258 TTTTCTGTACAAAAGGAATTAGG - Intronic
1079530225 11:21443546-21443568 TTTTTTTTCAAAATGGAAATGGG + Intronic
1079646513 11:22869933-22869955 TTTTGGGGCAAAAGGGAAGCAGG - Intergenic
1081144993 11:39552483-39552505 TTTTGTGTCATAAATGACCTAGG + Intergenic
1082874628 11:57975419-57975441 CTTTTTCTAAAAAAGGAAGTGGG - Intergenic
1082913935 11:58410331-58410353 CTTTGTCTCAAAAAGAAAGAAGG - Intergenic
1083933745 11:65859832-65859854 TTTTGTGGCTAATCGGAAGTGGG - Intronic
1084141606 11:67234844-67234866 CCTTGTCTCAAAAAGAAAGTAGG + Intronic
1084375220 11:68772345-68772367 TTCTGTCTCAAAAAAAAAGTTGG + Intronic
1084885251 11:72200216-72200238 TTTTGGTCCAAAAAAGAAGTGGG - Intergenic
1085240650 11:75051149-75051171 TTCTGAGTCACCAAGGAAGTGGG + Intergenic
1085282824 11:75342033-75342055 CTATGTGTCAAGCAGGAAGTAGG - Intronic
1085291879 11:75406621-75406643 TTATGAGTCAAAAAGGAAGGGGG - Intronic
1085881254 11:80469052-80469074 TTTAATGTCAAAAATAAAGTTGG + Intergenic
1086372273 11:86166834-86166856 TTCTTTTTCAAAAAGGAAGAAGG + Intergenic
1086591320 11:88517784-88517806 TTTTCTGTAAAAAAGGAAAAAGG - Intronic
1086800837 11:91172946-91172968 TTTTTTTTAACAAAGGAAGTGGG - Intergenic
1087387306 11:97488163-97488185 GTTTGAGGCAAAAAAGAAGTTGG - Intergenic
1088060894 11:105648243-105648265 TATTTTTTCCAAAAGGAAGTAGG + Intronic
1088437092 11:109826099-109826121 TTTTGTGCCAGAAACTAAGTTGG + Intergenic
1090543845 11:127739703-127739725 TTTCGTGTCAATAAAGAAGCAGG - Intergenic
1091846218 12:3658104-3658126 TTTGGTGTCAAGAAGGGAGAAGG + Intronic
1092906652 12:13106331-13106353 TTTTGTGTAAAAAAGAAAAGAGG + Intronic
1093135529 12:15445523-15445545 TTATGTGTCAAAAATGTATTTGG + Intronic
1095336528 12:41034807-41034829 TTTTGTAACAAACATGAAGTTGG + Intronic
1095491165 12:42735033-42735055 TTTTGTGTGAAAAAGTATTTTGG + Intergenic
1095717043 12:45357671-45357693 TTTTGTTTGAAAAAGAAAGGAGG + Intronic
1095963390 12:47850253-47850275 TTTTGAGTGATATAGGAAGTAGG - Intronic
1098337060 12:69415270-69415292 TTTAGTGTCAAAAAGGTATTTGG + Intergenic
1098415630 12:70231460-70231482 TTTTGTTTCTATAAGGAACTAGG + Intergenic
1098974329 12:76886771-76886793 TTATGTCCCAAAAAGGAGGTGGG - Intergenic
1099642106 12:85303670-85303692 CACTGTGTAAAAAAGGAAGTTGG - Intergenic
1099946724 12:89253666-89253688 TTTTGTGCCAAAAGGGTATTTGG + Intergenic
1101164700 12:102016529-102016551 TTTTTTTTCAAAAAGTAAGTAGG - Intronic
1102262103 12:111449378-111449400 TTTTGAGCCAAAATGGAAGCTGG + Exonic
1102377801 12:112437648-112437670 TTTAGTTTGTAAAAGGAAGTTGG + Intronic
1104038035 12:125112036-125112058 TTTTAAGTGAAAAAGAAAGTGGG + Intronic
1105064774 12:133186889-133186911 TTGTGTTACAAAAAAGAAGTGGG - Intronic
1105637929 13:22233808-22233830 TTTTGTGTTTATAAGGAATTTGG - Intergenic
1106355651 13:28980478-28980500 TTTTATGTAAAAAGGGGAGTAGG - Intronic
1106477074 13:30108140-30108162 TTTTTTTTAAAAAAGGAAGTGGG + Intergenic
1106975839 13:35213154-35213176 TTTTGTGACTAAAATGAGGTAGG + Intronic
1107183151 13:37485572-37485594 ATCTCTGTCAAAAAAGAAGTAGG + Intergenic
1107260816 13:38488924-38488946 CTTTGTTTCTAAAAGGATGTAGG - Intergenic
1107516410 13:41133768-41133790 TTTTGTGTAAAAAAGGGAAAGGG - Intergenic
1108072406 13:46641744-46641766 TTTTGTATGAAAAAGGAAAGTGG - Intronic
1108666252 13:52634317-52634339 TTTTATTTTAAAAAGCAAGTGGG - Intergenic
1108772308 13:53718530-53718552 TTTTTTGTCAAACACCAAGTGGG + Intergenic
1108951717 13:56102570-56102592 GTTTGTGTCCAAAAAGAAGTAGG + Intergenic
1109231548 13:59763874-59763896 TTTTGTGTGAATAAGTAAGTTGG + Intronic
1109656106 13:65392339-65392361 TTTTCTGTAAAAATGGAGGTAGG - Intergenic
1110029083 13:70582658-70582680 TTTTTTGGAAAAAAGAAAGTGGG - Intergenic
1111025170 13:82511083-82511105 TTTTGAGTCCAAAGGGCAGTTGG + Intergenic
1112490784 13:99861453-99861475 TTTGGTGTTAAAAATGTAGTAGG - Intronic
1112718607 13:102215795-102215817 TTTTGAGTGAAAAAGGGAATAGG + Intronic
1112751407 13:102587556-102587578 ATTTGTGTAAAAAAGGAAAGAGG + Intergenic
1114162088 14:20179480-20179502 TCTTGTGTCAGAGAGGAAGTTGG - Intergenic
1114163734 14:20197697-20197719 CTTGGTGTCAGAGAGGAAGTTGG - Exonic
1115204212 14:30884608-30884630 TTGTTTGCCATAAAGGAAGTAGG + Exonic
1115989042 14:39132522-39132544 CTCTGTCTCAAAAAAGAAGTAGG + Intronic
1116985262 14:51212503-51212525 TTTTTTGTCAAAAATGAATATGG - Intergenic
1117126031 14:52627089-52627111 TTTTTTTTAAAAAAGGAAATTGG + Intronic
1117213126 14:53522212-53522234 TTCTGTGTGAAAAAGAAAGAAGG - Intergenic
1117667332 14:58070288-58070310 CTTTGAGTCAAAAAGGAAGGTGG + Intronic
1118369660 14:65126650-65126672 TTTTGTGTCAGAAATTAAGGAGG + Intergenic
1119787159 14:77322081-77322103 TTTTGTGGCACTAAGGAAGGTGG + Intronic
1121021817 14:90584864-90584886 TTTTATGTGAAAAAGAAGGTGGG - Intronic
1121695236 14:95907130-95907152 TGTGGTGGCAAAAAGGAAGGAGG - Intergenic
1122301832 14:100735784-100735806 TTTTTTCCCAAAAGGGAAGTGGG - Exonic
1124192455 15:27592118-27592140 GTTTGAGTGAAAAAGGAAGAGGG + Intergenic
1124378628 15:29145309-29145331 TTTTTTATCAAAAAGAAAGTTGG - Intronic
1126587674 15:50305740-50305762 TTTTGTGTCAATAACCAAGAAGG - Intronic
1127039767 15:54961868-54961890 TGTTGGGACAAAAAGGAAGGGGG - Intergenic
1127501862 15:59561215-59561237 TTTTATGTCAAGGAGGATGTAGG + Intergenic
1128574114 15:68758585-68758607 TTTTGTGTGGAAAAAAAAGTGGG + Intergenic
1128668835 15:69559112-69559134 TTTTGTGGCAATAAGAAAATGGG - Intergenic
1128700270 15:69798859-69798881 TTCTGTGTCAACAAGGCTGTAGG - Intergenic
1129080027 15:73031545-73031567 TTTTGAATTAAAAAGGAAGGAGG + Intergenic
1130877978 15:88030755-88030777 TTTTTTTTTAAAAAGGAAGAAGG - Intronic
1132138960 15:99373349-99373371 TTTTTTTTAAAAAATGAAGTTGG - Intronic
1132320535 15:100921472-100921494 TTTTGTTTCAAAAAGGAACTAGG + Intronic
1133101439 16:3482521-3482543 TTGTGTGTCAACAGAGAAGTTGG - Exonic
1133507725 16:6428802-6428824 TTTTGAGTCAAAATGGCAATGGG + Intronic
1135852596 16:25978100-25978122 TTTTGTGTCAAAAACGTTGAAGG - Intronic
1138004802 16:53322792-53322814 TTTTGTTTCAGAAAGGGAGGTGG + Intronic
1138863245 16:60785399-60785421 TTGTGTGTAAAAAAGGCAGAGGG - Intergenic
1139710948 16:68775575-68775597 TTTTGTGTTTAAAAGCATGTAGG + Intronic
1140301568 16:73762994-73763016 ATTTTTTTTAAAAAGGAAGTGGG + Intergenic
1140408673 16:74727839-74727861 TTTTGTATCAGGAATGAAGTGGG + Intronic
1142652230 17:1362137-1362159 TTTTGTGTCAAGAAGGAAGAAGG - Intronic
1144030975 17:11323270-11323292 ATTTGTATCATAAAGGAAGTTGG - Intronic
1144878524 17:18417408-18417430 TTTTGTGTCAAAAGGGAAGAAGG + Intergenic
1144885229 17:18453832-18453854 TTTTGTGTCAAAAGGGAAGAAGG - Intergenic
1145146989 17:20490545-20490567 TTTTGTGTCAAAAGGGAAGAAGG + Intergenic
1145153711 17:20526979-20527001 TTTTGTGTCAAAAGGGAAGAAGG - Intergenic
1145177056 17:20709637-20709659 TTTTGTGTCAAAAGGGAAGAAGG + Intergenic
1145177126 17:20710674-20710696 TTTTGTGTCAAAAGGGAGGAAGG - Intergenic
1145758784 17:27412938-27412960 TTTTGTGTCAAGAGGGAAGAAGG - Intergenic
1145812635 17:27773709-27773731 TTTTGTGCCAAAAAGGACTTGGG - Intronic
1146404226 17:32523312-32523334 TCTTGTCTGTAAAAGGAAGTTGG - Intronic
1146853254 17:36241538-36241560 TTTTGTGTCAAAAGGGAGGAAGG + Intronic
1146869162 17:36365428-36365450 TTTTGTGTCAAAAGGGAGGAAGG + Intronic
1147058623 17:37855370-37855392 TTTTGTGTCAAAAGGGAGGAAGG - Intergenic
1147072036 17:37966059-37966081 TTTTGTGTCAAAAGGGAGGAAGG + Intergenic
1147083562 17:38045591-38045613 TTTTGTGTCAAAAGGGAGGAAGG + Intronic
1147099508 17:38169558-38169580 TTTTGTGTCAAAAGGGAGGAAGG + Intergenic
1147630241 17:41925642-41925664 TGTTGTGTTGAGAAGGAAGTGGG + Intronic
1148991157 17:51668381-51668403 TTTGGGTTCAGAAAGGAAGTGGG - Intronic
1149462691 17:56844399-56844421 TTTCATGTCTAAAAGGAAATTGG + Intronic
1149525494 17:57352398-57352420 TTTTATTTTATAAAGGAAGTAGG + Intronic
1150082521 17:62252848-62252870 TTTTGTGTCAAAAGGGAGGAAGG + Intergenic
1151026910 17:70687533-70687555 ATTTGAATTAAAAAGGAAGTAGG + Intergenic
1153341606 18:3980445-3980467 ATTTGTGTCCAAAATGAAGTGGG + Intronic
1155298362 18:24406295-24406317 TTTTCTGTTAAAATGGAAGAGGG + Intergenic
1155910751 18:31502052-31502074 TTTTGTTTCTAAAAGTTAGTAGG + Intronic
1156227801 18:35126308-35126330 TCTTGTGTCAAAAAGCAAGGAGG - Intronic
1156556687 18:38076417-38076439 TTCAGTGTTAATAAGGAAGTGGG + Intergenic
1156572280 18:38270347-38270369 TTTTGTGTATAGAAAGAAGTAGG + Intergenic
1156635691 18:39026319-39026341 GTTTGTGTTAAAAAAAAAGTTGG + Intergenic
1158409650 18:57194145-57194167 TTATTTTTTAAAAAGGAAGTAGG - Intergenic
1158582239 18:58693774-58693796 TTTTGTGTCAGAAGGGATTTGGG + Intronic
1158735974 18:60079969-60079991 TTTTGTGACAAAAATGACTTTGG - Intergenic
1158968873 18:62647774-62647796 TTTTGGCTCAAAAAGCAAATGGG - Intergenic
1159501297 18:69274331-69274353 TTTTGTGACAAAAAGAACATGGG + Intergenic
1160164572 18:76498665-76498687 TTTTGTGTATAAATGGAAATTGG + Intergenic
1161032729 19:2065893-2065915 CTCTGTCTCAAAAAGTAAGTAGG + Intergenic
1161285273 19:3465138-3465160 TTTTTTTTTAAAGAGGAAGTGGG - Intronic
1162656224 19:12132522-12132544 TCTTGTGTTTCAAAGGAAGTGGG + Exonic
1166211081 19:41306834-41306856 TATTTAGTCAAAAAGGAAGAAGG - Exonic
1166576460 19:43843366-43843388 TGTTTTGTCAAAAAAGCAGTTGG - Intronic
925620958 2:5792086-5792108 TATTGTGTCAAGAAGGGATTTGG + Intergenic
926211790 2:10876494-10876516 TTTTATTACAAAGAGGAAGTAGG - Intergenic
926804763 2:16697234-16697256 TTCTGTGTGAAAAATGATGTTGG + Intergenic
927258134 2:21058654-21058676 TTTTGTATAAAATAAGAAGTTGG - Intergenic
927399351 2:22693167-22693189 TTTAGTTTAAAAAAGGAAATTGG + Intergenic
927764647 2:25794716-25794738 TTTTGTACATAAAAGGAAGTGGG + Intronic
928866758 2:35926053-35926075 TCTTGTGTCAGAAAGCAAGGAGG + Intergenic
929488112 2:42372730-42372752 TTTCATGTCAAAAAGGCAGTGGG + Intronic
929878478 2:45816497-45816519 TTTTGTGTCAACTAGGGAGCTGG + Intronic
929953432 2:46435296-46435318 TTTTGTTTCAATGAGAAAGTTGG + Intronic
930619011 2:53625141-53625163 GTTTGTGTCAGAGTGGAAGTGGG - Intronic
931928585 2:67103237-67103259 TTTTGTAACAAAATGGAAATTGG - Intergenic
931945415 2:67300838-67300860 ATTTATGTCAAAAAGGAACATGG + Intergenic
932133457 2:69208078-69208100 AATTGTGTCAAAAAGGAAGAGGG + Intronic
932675582 2:73778123-73778145 TTTTGTTTAAAATATGAAGTAGG + Intronic
932967416 2:76492826-76492848 TTTTGTTACCAAAAGGAAGTAGG + Intergenic
933088457 2:78087768-78087790 TTTAGGGTCTAAAAGGAATTTGG - Intergenic
935298791 2:101674675-101674697 ATTTGTCTCAAAAACAAAGTGGG + Intergenic
936124052 2:109771657-109771679 TTTGGAGTCTGAAAGGAAGTAGG + Intergenic
936170354 2:110166336-110166358 TTTTGTTTGAAAAAGGAGGTGGG - Intronic
936220637 2:110599807-110599829 TTTGGAGTCTGAAAGGAAGTAGG - Intergenic
936341759 2:111639971-111639993 TTATGTGACAAAAAGGAATAAGG + Intergenic
937665488 2:124482679-124482701 TTTGGTGTGAAAAAGGAAGGAGG + Intronic
939562265 2:143746279-143746301 TTTTTTTTGAAAAAGGAATTTGG - Intronic
939564537 2:143771459-143771481 TTCTGTGTCAATAAGAAAGAGGG - Intergenic
941543908 2:166821277-166821299 GTGTGTTTGAAAAAGGAAGTGGG + Intergenic
941744058 2:169067578-169067600 CTTTGTTTTAAAAAGGAACTAGG + Intronic
943674270 2:190701764-190701786 TTTTCTGTTAAAAAGGGATTGGG + Intergenic
943908568 2:193532864-193532886 TTTTGTGCTAAAAAGGAAGGGGG - Intergenic
944140314 2:196449073-196449095 TTATGTGTTAAAAAGGAAGATGG + Intronic
944562358 2:200953419-200953441 TTTTTTTTAAAAAAGGAAATAGG + Intronic
944845348 2:203662597-203662619 TTATGTGTCAAAAAGAAAAATGG + Intergenic
944983651 2:205150398-205150420 TTTTGTAGCAAAATGGAAATGGG - Intronic
945437317 2:209833976-209833998 TTTGGAGGCAAGAAGGAAGTTGG - Intronic
945612930 2:212028848-212028870 TTTTATTGCAAAAAGTAAGTGGG + Intronic
948207410 2:236169451-236169473 TTTTGTTTGAAAATGGAAGAGGG - Intergenic
948242856 2:236452834-236452856 ATTTTTTTAAAAAAGGAAGTTGG - Intronic
948494522 2:238338351-238338373 TTTTATGTCAGGAAGGAAGGAGG + Exonic
1168853349 20:991433-991455 TTTTGTGTCAAAATGAACATGGG + Intronic
1170212207 20:13856664-13856686 CTGTCTTTCAAAAAGGAAGTTGG - Intronic
1172373375 20:34415233-34415255 TCATGAGTCAAAGAGGAAGTAGG - Intronic
1172628324 20:36361440-36361462 TTTTGTGTCAGCAAGGATTTTGG + Intronic
1173177986 20:40779064-40779086 CTTTGTGTAAAAAGGGAAGGAGG + Intergenic
1174522691 20:51144047-51144069 TCTTTTGTTAAAAAGGAAGATGG + Intergenic
1174619498 20:51863274-51863296 TTTTCTGGCAAGACGGAAGTAGG + Intergenic
1176668204 21:9706679-9706701 ATTTATGTCAATTAGGAAGTGGG - Intergenic
1177476931 21:21635446-21635468 ATTTGAGGCAAAATGGAAGTAGG - Intergenic
1178055092 21:28789635-28789657 TTTTGTGTCAAACTTTAAGTAGG - Intergenic
1178363922 21:31972750-31972772 TTTTGTGACAAACAGGAATGAGG + Intronic
1178562766 21:33654566-33654588 TTTTGTGTAGAGAAGGAGGTAGG - Intronic
1180580606 22:16832481-16832503 TTTTGTGTCAAAGAGAAAAAGGG + Intergenic
1182327841 22:29527482-29527504 ATTTGTGTAAAAAATAAAGTGGG + Intronic
1182755150 22:32673270-32673292 TGTTGTGTCAGAAATGAAGAGGG + Intronic
1182982783 22:34687113-34687135 ATTTGTATCAAAAAGGATTTTGG + Intergenic
1183148068 22:36013776-36013798 ATTTGTGTCAAAAAGAAAGGAGG + Intronic
1183245771 22:36692324-36692346 TATAGTGTCAGTAAGGAAGTGGG + Intronic
1183338024 22:37261984-37262006 TTTTCTGTGAAAAATGACGTTGG + Intergenic
951934596 3:28007959-28007981 TTTTGTTTAAAAACGAAAGTAGG + Intergenic
952299330 3:32090022-32090044 TTTTGTGTAAAAAAAGAAAAGGG + Intergenic
956757856 3:72406890-72406912 GTTTGTATCAAAAATGCAGTAGG + Intronic
957155756 3:76541914-76541936 TATTTTCTCAAGAAGGAAGTGGG - Intronic
957399890 3:79696954-79696976 TATTGTCTCAAAAAGGATATTGG + Intronic
957419419 3:79949872-79949894 TGTTGTATCAAACAGAAAGTGGG + Intergenic
957962555 3:87276684-87276706 TTTGGGGTAAAAAAGGAAGACGG - Intergenic
958517826 3:95142640-95142662 TTTAGTGGCAGAAAGGCAGTAGG + Intergenic
959294801 3:104521873-104521895 TTTTGAGTCACAGATGAAGTAGG - Intergenic
960682063 3:120259601-120259623 TTTTGTGTAAGAAAGGAGATAGG + Intronic
960727804 3:120688326-120688348 CTTTGTGTCAAAAAGAAACCAGG + Exonic
960737481 3:120796532-120796554 CATGGTGTCAAAAAGGAACTTGG + Intergenic
961011724 3:123440803-123440825 TTTTGCCTCAAAAAGGAAGGGGG + Intronic
961966336 3:130907808-130907830 ATTTCTGTTAAAAAGGCAGTTGG + Intronic
963483742 3:145909511-145909533 TATTCTGTCAAAAAGGTAGAGGG + Intergenic
963765682 3:149333753-149333775 CCTTGTGTTAAGAAGGAAGTTGG + Exonic
964123597 3:153212089-153212111 TTTTGTGTCAGAAAATAAGGAGG + Intergenic
964451681 3:156818498-156818520 TTTTGTCACCAAAAGGAACTGGG - Intergenic
965119561 3:164535845-164535867 TTTTGTGGCATAAAAGAAGTGGG + Intergenic
966084763 3:176056669-176056691 TTATGTGTTAAAAAGGTATTAGG - Intergenic
966314253 3:178627454-178627476 TTTTCTTTCAAAAAAGAACTGGG - Intronic
967121016 3:186383091-186383113 TTTTGTGCTAAAAAGGAAATAGG + Intergenic
968709220 4:2100870-2100892 TTTTGTGTATGATAGGAAGTAGG - Intronic
969191453 4:5524346-5524368 TTTTGAGTCAAAACTGAAGTAGG - Intergenic
969838577 4:9863632-9863654 TTTTGTTTCAATAAAGAAGTTGG + Intronic
970146988 4:13046375-13046397 TTTTGTGTAAAATTGGGAGTGGG + Intergenic
970185596 4:13448214-13448236 TTCTTTGTGAAAAAGGAATTTGG - Intronic
970361903 4:15318374-15318396 TTTTGTGTAAAAAATGAAAAGGG + Intergenic
970456541 4:16228129-16228151 TTGATTGTCAAGAAGGAAGTAGG + Intergenic
971855549 4:32038889-32038911 TTATTTATCAAAAAGGAAGAAGG + Intergenic
973006329 4:45011172-45011194 TTTGGTTTCCAAAAGGAAGTTGG + Intergenic
973775385 4:54236973-54236995 TTCTGTCTCAAAAAAAAAGTGGG - Intronic
974145356 4:57940476-57940498 TTTTCTGTCTAAATGTAAGTTGG - Intergenic
974258475 4:59493083-59493105 ATTTCTTTCAAAAAGGAATTAGG - Intergenic
974714804 4:65654227-65654249 TTTTTTTTCAAGAAAGAAGTTGG - Intronic
974817588 4:67025219-67025241 TTGTGTGTCACAAAGGAGGTTGG + Intergenic
976043110 4:80912030-80912052 TTTTGTCTCTAAAAGAAAGAAGG - Intronic
976053802 4:81039231-81039253 TTTTGTTTGAAGAAAGAAGTTGG + Intronic
976250742 4:83049409-83049431 TGTTTTGTCAAAAATGAAATTGG - Intronic
976307327 4:83573625-83573647 TTATGGGTCAGGAAGGAAGTTGG + Intronic
977228915 4:94428234-94428256 TTTTGTGTGAATTAAGAAGTAGG - Intergenic
977856151 4:101896802-101896824 ATGTGCTTCAAAAAGGAAGTGGG + Intronic
977932872 4:102767632-102767654 TATTCTGTGAAAAATGAAGTTGG - Intergenic
978531560 4:109720160-109720182 TATTGTGTAAAATAGGGAGTTGG - Intronic
979563381 4:122125482-122125504 TTTTGTTTGAAAAAGGAATTTGG - Intergenic
979700633 4:123663306-123663328 TATTGTGGCATAAAGGAAATGGG - Intergenic
979817124 4:125122809-125122831 TTTGGTGTTAAGTAGGAAGTTGG + Intergenic
980228202 4:130014450-130014472 TTTTGTGTCAAAATAGAACCTGG - Intergenic
980581443 4:134759063-134759085 TTTTGGGGAAAAAAGGAAGGAGG - Intergenic
981127737 4:141126194-141126216 TCTTGTGAGAAAAATGAAGTGGG + Intronic
982063277 4:151625710-151625732 TTTTCTTTTAAAAAGGAGGTGGG - Intronic
982394810 4:154904739-154904761 TTTTGTAACAAAAAAAAAGTGGG + Intergenic
982558275 4:156897089-156897111 TTCTATGTAAAATAGGAAGTAGG + Intronic
982763303 4:159315185-159315207 TTTTGTGTGAAGACGCAAGTGGG + Intronic
982914515 4:161189186-161189208 TTCTGTGTCAAAATAGCAGTTGG + Intergenic
985015705 4:185632299-185632321 TTTTCTGTCTAAAAGGAGGATGG - Intronic
985125902 4:186694020-186694042 TTTTGTGAGAAATAGGAAGATGG - Intronic
985340222 4:188943514-188943536 TTTTCTATCATAAAGGAAGAAGG - Intergenic
985340643 4:188949225-188949247 CTCTGTTTTAAAAAGGAAGTAGG + Intergenic
985406578 4:189644812-189644834 ATTTATGTCAATTAGGAAGTGGG + Intergenic
987689382 5:21246735-21246757 TTTTATGTCAGAAAGACAGTTGG + Intergenic
987943424 5:24572309-24572331 GTCTGTTTTAAAAAGGAAGTGGG - Intronic
989576217 5:42991084-42991106 TTTCTTATCAGAAAGGAAGTAGG + Intergenic
989658573 5:43772945-43772967 CATTATGTCAAACAGGAAGTAGG + Intergenic
990409409 5:55526066-55526088 TTTTTTTTAAAAAAAGAAGTTGG - Intronic
990965287 5:61440311-61440333 TTTTGTGTGAAAAAGAAAAATGG + Intronic
992912736 5:81413971-81413993 TTTGGTGGAAAAAAGAAAGTGGG + Exonic
993241183 5:85387848-85387870 ATATGTGGCAAATAGGAAGTAGG - Intergenic
993658434 5:90600866-90600888 TTTTGTTTTTAAAAAGAAGTAGG - Intronic
993773674 5:91963848-91963870 TTTTGTCTCAATAAGTAAGAAGG + Intergenic
993775386 5:91988555-91988577 TTTGGTGTTAAAAAGAAATTAGG + Intergenic
994122560 5:96133359-96133381 TTTTGAGAGAAAAAGGATGTGGG + Intergenic
994896756 5:105715358-105715380 TTTTGTATCATAAATGATGTTGG - Intergenic
995250244 5:109984780-109984802 TTTTGTCACAAAAAAGAAGAAGG + Intergenic
995640996 5:114257380-114257402 TATTCTGTGAAAAATGAAGTTGG + Intergenic
995819945 5:116218626-116218648 ATTTGTGTCAAACAGGGAATAGG - Intronic
996859838 5:128052746-128052768 TTTTTTATCAATAAGGAACTTGG - Intergenic
997290163 5:132726040-132726062 TTTTGTTTAAAAAAAGAAGGGGG + Intronic
998521752 5:142807470-142807492 TTGTGTGTGAAAAGGGAACTGGG + Intronic
999043446 5:148442170-148442192 TATTTTGTCAGAAAGCAAGTAGG + Exonic
999523315 5:152375533-152375555 TTTTGTCTGAGAAAGGAAGAAGG - Intergenic
999571478 5:152924799-152924821 TTATGTGTCAGCAAAGAAGTTGG + Intergenic
999833738 5:155346718-155346740 TTTTGTGCCACAAAGCAAGAAGG - Intergenic
999877047 5:155818876-155818898 GTTTATGTCAAAAAAAAAGTTGG - Intergenic
1000488913 5:161884688-161884710 ATTTTTGTTAGAAAGGAAGTTGG + Intronic
1001774462 5:174318110-174318132 TTTTTTGACAAAAAGCAAGGTGG + Intergenic
1002858509 6:1058925-1058947 TTCAGTGTCAAAAGGGAAGGAGG + Intergenic
1003188550 6:3853133-3853155 CTTTGTCTCAAAAAAAAAGTTGG + Intergenic
1004078577 6:12368506-12368528 ATTTGGGTCAAAAAGGAATAAGG + Intergenic
1004781456 6:18913168-18913190 TTTTGTTTCATTAAAGAAGTGGG - Intergenic
1006524343 6:34590910-34590932 ATTTTTGTCAAGAAGGAAATAGG - Intronic
1006586224 6:35115500-35115522 ATTTCTGTAAAACAGGAAGTTGG - Intergenic
1006790222 6:36695805-36695827 TATTATGTCATAAAGGATGTAGG - Intergenic
1007396117 6:41578750-41578772 TTTTGTGTCACAAAGAACTTGGG + Intronic
1007434168 6:41796632-41796654 TTGAGTGTAAAAAAGGATGTAGG + Exonic
1007534491 6:42573647-42573669 TTTTGTACCTAAAAGAAAGTAGG + Intronic
1008075001 6:47136507-47136529 ATTGGTATCAAAAAGCAAGTTGG - Intergenic
1008241277 6:49115242-49115264 TCTTGGGGCAAAAAGGAAATGGG - Intergenic
1010259340 6:73797223-73797245 TTTGCTGTCAAAAAGGAAAATGG + Intronic
1010666579 6:78637941-78637963 TTTTGTGGGAAATAGGAAGACGG - Intergenic
1010719513 6:79266563-79266585 ATTTCTGAAAAAAAGGAAGTTGG - Intergenic
1011480665 6:87790511-87790533 TTTTTTATCAAAATGTAAGTAGG + Intergenic
1011759555 6:90547138-90547160 TTTTTTTTTAAATAGGAAGTAGG - Intronic
1012994798 6:105962314-105962336 TTTTCTTCCAAAAAGGATGTAGG - Intergenic
1013781925 6:113738262-113738284 TTCTGTGACAAAATGGAGGTTGG - Intergenic
1013920710 6:115399382-115399404 TTTTGTGTAAGAAATGAAGGAGG - Intergenic
1014392929 6:120886340-120886362 CTTTGTGTCAAAAAGGGAGGTGG + Intergenic
1015560724 6:134512455-134512477 TTTTATGTGATAAAGGAAGCTGG + Intergenic
1015738988 6:136433120-136433142 TTTTTTTTCAGAAAGGAAGAAGG - Intronic
1016464441 6:144311478-144311500 CTTAGTGTCAAAGAGGAACTAGG + Intronic
1016516650 6:144900131-144900153 TTTTGTGTGTAATATGAAGTGGG + Intergenic
1017245828 6:152223609-152223631 CTCTGTCTCAAAAAGGAAGGAGG + Intronic
1017829647 6:158114760-158114782 CTTTTTGTCATAAAGGAAATTGG - Intronic
1017942168 6:159062429-159062451 ATCTGTGTCAGAAAGGAAGTGGG + Intergenic
1019842274 7:3459545-3459567 TCCTGTTTCAAGAAGGAAGTGGG + Intronic
1020625475 7:10573322-10573344 TTTTCTGACTAAAAAGAAGTAGG + Intergenic
1022633850 7:32112358-32112380 ATATTTGTCAAAAATGAAGTTGG - Intronic
1022862946 7:34386863-34386885 ATTTGTGTAAAAGGGGAAGTGGG - Intergenic
1023099318 7:36698199-36698221 TTTTGTGCCAAGAAGGTAGAGGG - Intronic
1023248714 7:38234773-38234795 TCTTGGGGCAAAAAGGAAATGGG - Intergenic
1023389246 7:39692434-39692456 TCCTATGTCAAAAATGAAGTTGG + Intronic
1023604751 7:41919443-41919465 TTTTGTGTCAAGATAGAATTTGG - Intergenic
1024363988 7:48500479-48500501 TTATTTTTCAAAAAGGAAGATGG - Intronic
1024623200 7:51181539-51181561 TTTTAGGGCAAAAAGGAAGAAGG - Intronic
1025988047 7:66473308-66473330 TTGATTGTCAAGAAGGAAGTAGG - Intergenic
1027008884 7:74724484-74724506 ATATGTTGCAAAAAGGAAGTTGG + Intronic
1027211035 7:76149203-76149225 TTGATTGTCAAGAAGGAAGTAGG - Intergenic
1027665215 7:81036278-81036300 TTTTCTGCCAAAACGGAATTCGG - Intergenic
1028184397 7:87765505-87765527 ATTTGTTTCAAAAAGAATGTTGG + Intronic
1028196333 7:87912046-87912068 TTTTGTGTGAAAAGAGAAGTAGG - Intergenic
1028853274 7:95560964-95560986 TTTTCTGGCAAAAGGGAAATGGG + Intergenic
1028980608 7:96963957-96963979 TTTGGAAACAAAAAGGAAGTTGG - Intergenic
1030298297 7:107950791-107950813 TCTTGTGCCATCAAGGAAGTTGG + Intronic
1031563772 7:123269289-123269311 TTTTGTGTGAAAAGGGAGTTAGG - Intergenic
1031705170 7:124971810-124971832 TGTAGTGTCAAAAATGAAGAAGG + Intergenic
1031715012 7:125098101-125098123 CTTTGTTTGAAAAAGGAGGTTGG + Intergenic
1033386360 7:140880072-140880094 TTTTGTGAAAAAAAGTCAGTCGG - Intronic
1033850921 7:145493637-145493659 TTTTGTTTCAAAAGGAAATTAGG - Intergenic
1036681729 8:10879138-10879160 TTTGGAGTGAAGAAGGAAGTCGG - Intergenic
1037426109 8:18756616-18756638 TTATGTGGCAAAAAAGAAATTGG - Intronic
1037876199 8:22549828-22549850 CTTTGTGAGAAACAGGAAGTGGG + Intronic
1038081106 8:24137265-24137287 TTTTGGGTAAAATAGGAAATAGG + Intergenic
1038709097 8:29924473-29924495 TTTGATGTAAGAAAGGAAGTAGG + Intergenic
1038969305 8:32614220-32614242 ATTTATGTCAAAGAGGCAGTAGG - Intronic
1039137422 8:34341154-34341176 TTTTGAGGAAAAAAGGAATTAGG + Intergenic
1039482702 8:37886577-37886599 TTTTGTGTAGCCAAGGAAGTAGG - Intronic
1039675200 8:39656351-39656373 TTTTGTGACAAAAAGGACAGAGG + Intronic
1040888096 8:52287402-52287424 CTTTGTCTCAAAGAGGAGGTAGG + Intronic
1041456764 8:58069037-58069059 TTATGTATCTAAAAAGAAGTAGG + Intronic
1041674300 8:60522509-60522531 TTTTTTTTAAAAAAGAAAGTAGG - Intronic
1041880219 8:62741281-62741303 TTTTGAGTTAAAGAGGAAGTGGG + Intronic
1043467079 8:80520194-80520216 ATTCATGTCAAAAAGGAAGAGGG - Exonic
1043486898 8:80706614-80706636 TTGTGTGCCACAAAGGCAGTGGG + Intronic
1044168255 8:89016577-89016599 TTTGGGGAAAAAAAGGAAGTGGG + Intergenic
1044771614 8:95641577-95641599 TTCAGTGTCAAGAAGGAAGATGG - Intergenic
1045179596 8:99765953-99765975 TTTTGTGTAAAGAATGATGTAGG + Intronic
1045496113 8:102710290-102710312 TTTTCTAAGAAAAAGGAAGTAGG + Intergenic
1045624907 8:104033768-104033790 GTTTGTTTCTAAAAGGAAATTGG + Intronic
1046061657 8:109147012-109147034 TTATGTGACAGAAAGGTAGTAGG - Intergenic
1048460369 8:134616331-134616353 TTTGGTGTCCAAAAGGGAGTGGG - Intronic
1049654970 8:143793335-143793357 TTTTGTCTAAAAAAGGCAGGTGG + Intronic
1050170228 9:2808029-2808051 TTTTGTGTTAAAAGGGAGATTGG - Intronic
1050951461 9:11601022-11601044 AATTGTGTCAAAATGGAAGGAGG - Intergenic
1051249226 9:15142505-15142527 TTTTGTGTTAAAGTGGAAGGTGG - Intergenic
1056736611 9:89215214-89215236 TTCTGTAACAAAAAGGAAGGGGG + Intergenic
1057486071 9:95485257-95485279 TTTTGTGTCACACAGCACGTTGG - Intronic
1058506388 9:105670463-105670485 TTTGGTCTGTAAAAGGAAGTAGG + Intergenic
1058645663 9:107129549-107129571 CATTGTGTGAACAAGGAAGTTGG - Intergenic
1058842576 9:108924474-108924496 ATTTGTGTGAAAAAGTCAGTGGG + Intronic
1060061712 9:120466587-120466609 ATTTGTGTCTCAAATGAAGTTGG + Intronic
1060962514 9:127691011-127691033 TTTTGTTTCAAACAAGAAGAGGG - Exonic
1061605591 9:131708115-131708137 TTTTCTCTTAAAAAGAAAGTAGG - Intronic
1061685429 9:132272918-132272940 ATTTCTGTAAAAAAGGCAGTTGG - Intronic
1203657663 Un_KI270753v1:14276-14298 ATTTATGTCAATTAGGAAGTGGG + Intergenic
1186222069 X:7360079-7360101 TTCTGTGTCAAAATGGGAGAAGG + Intergenic
1186605254 X:11083199-11083221 TTTTGTTTATAAAAGCAAGTGGG + Intergenic
1186646246 X:11510233-11510255 TTTTCTGTCTAGAAGAAAGTTGG + Intronic
1186920443 X:14273219-14273241 TTTGGTATTCAAAAGGAAGTTGG + Intergenic
1187749924 X:22451290-22451312 TTTTCTGTGAAAAATGATGTTGG - Intergenic
1187772997 X:22723064-22723086 TTTTGTGAAAAAAATGATGTTGG + Intergenic
1188800470 X:34524017-34524039 TTTTGTGTGATAAAGGTAATAGG + Intergenic
1189448096 X:41100037-41100059 TTTTGCATCAAAATGGAAGGGGG - Intronic
1189679230 X:43497895-43497917 ATTTGTGTCAATAATGAAATGGG - Intergenic
1191980690 X:66921635-66921657 TTTAAAGTGAAAAAGGAAGTAGG - Intergenic
1197464995 X:126792824-126792846 TTTTGAGTCACAACTGAAGTAGG + Intergenic
1197577362 X:128231947-128231969 TTTTGAGTCCAAAAGGCAGTGGG + Intergenic
1198504471 X:137287936-137287958 TTGTCTGTCAAAAATGGAGTGGG - Intergenic
1199288192 X:146077066-146077088 ATTTCTGTTGAAAAGGAAGTGGG + Intergenic
1200856590 Y:7945272-7945294 TTGTGTGTCAAAAACTAAGCAGG + Intergenic