ID: 1067133236

View in Genome Browser
Species Human (GRCh38)
Location 10:43585237-43585259
Sequence CTACTCATGGCTGAAACTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067133236_1067133240 8 Left 1067133236 10:43585237-43585259 CCTCAAGTTTCAGCCATGAGTAG No data
Right 1067133240 10:43585268-43585290 GCTTCCGGAGTGACCACAGCAGG No data
1067133236_1067133242 12 Left 1067133236 10:43585237-43585259 CCTCAAGTTTCAGCCATGAGTAG No data
Right 1067133242 10:43585272-43585294 CCGGAGTGACCACAGCAGGCTGG No data
1067133236_1067133239 -7 Left 1067133236 10:43585237-43585259 CCTCAAGTTTCAGCCATGAGTAG No data
Right 1067133239 10:43585253-43585275 TGAGTAGACTGGTCAGCTTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067133236 Original CRISPR CTACTCATGGCTGAAACTTG AGG (reversed) Intergenic
No off target data available for this crispr