ID: 1067133238

View in Genome Browser
Species Human (GRCh38)
Location 10:43585250-43585272
Sequence GAAGCTGACCAGTCTACTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067133238_1067133240 -5 Left 1067133238 10:43585250-43585272 CCATGAGTAGACTGGTCAGCTTC No data
Right 1067133240 10:43585268-43585290 GCTTCCGGAGTGACCACAGCAGG No data
1067133238_1067133242 -1 Left 1067133238 10:43585250-43585272 CCATGAGTAGACTGGTCAGCTTC No data
Right 1067133242 10:43585272-43585294 CCGGAGTGACCACAGCAGGCTGG No data
1067133238_1067133244 20 Left 1067133238 10:43585250-43585272 CCATGAGTAGACTGGTCAGCTTC No data
Right 1067133244 10:43585293-43585315 GGTTGTCTTTAACAGCAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067133238 Original CRISPR GAAGCTGACCAGTCTACTCA TGG (reversed) Intergenic
No off target data available for this crispr