ID: 1067133240

View in Genome Browser
Species Human (GRCh38)
Location 10:43585268-43585290
Sequence GCTTCCGGAGTGACCACAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067133236_1067133240 8 Left 1067133236 10:43585237-43585259 CCTCAAGTTTCAGCCATGAGTAG No data
Right 1067133240 10:43585268-43585290 GCTTCCGGAGTGACCACAGCAGG No data
1067133238_1067133240 -5 Left 1067133238 10:43585250-43585272 CCATGAGTAGACTGGTCAGCTTC No data
Right 1067133240 10:43585268-43585290 GCTTCCGGAGTGACCACAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067133240 Original CRISPR GCTTCCGGAGTGACCACAGC AGG Intergenic
No off target data available for this crispr