ID: 1067133413

View in Genome Browser
Species Human (GRCh38)
Location 10:43586778-43586800
Sequence CTGTGTTAGCAGAGACAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067133413_1067133419 27 Left 1067133413 10:43586778-43586800 CCTTCTTGTCTCTGCTAACACAG No data
Right 1067133419 10:43586828-43586850 CTTTTGAGCATGTTGGGAATAGG No data
1067133413_1067133415 -9 Left 1067133413 10:43586778-43586800 CCTTCTTGTCTCTGCTAACACAG No data
Right 1067133415 10:43586792-43586814 CTAACACAGTGCTCTTGTCAGGG No data
1067133413_1067133414 -10 Left 1067133413 10:43586778-43586800 CCTTCTTGTCTCTGCTAACACAG No data
Right 1067133414 10:43586791-43586813 GCTAACACAGTGCTCTTGTCAGG No data
1067133413_1067133417 21 Left 1067133413 10:43586778-43586800 CCTTCTTGTCTCTGCTAACACAG No data
Right 1067133417 10:43586822-43586844 TTCTGCCTTTTGAGCATGTTGGG No data
1067133413_1067133416 20 Left 1067133413 10:43586778-43586800 CCTTCTTGTCTCTGCTAACACAG No data
Right 1067133416 10:43586821-43586843 ATTCTGCCTTTTGAGCATGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067133413 Original CRISPR CTGTGTTAGCAGAGACAAGA AGG (reversed) Intergenic
No off target data available for this crispr