ID: 1067135655

View in Genome Browser
Species Human (GRCh38)
Location 10:43605463-43605485
Sequence CTGTTTGCGCAGATTAATCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067135655_1067135659 -6 Left 1067135655 10:43605463-43605485 CCCTGATTAATCTGCGCAAACAG No data
Right 1067135659 10:43605480-43605502 AAACAGTGCTGAGAGGGAAGCGG 0: 1
1: 0
2: 8
3: 46
4: 432
1067135655_1067135661 28 Left 1067135655 10:43605463-43605485 CCCTGATTAATCTGCGCAAACAG No data
Right 1067135661 10:43605514-43605536 CCTGAACTGACAGAGACTAGTGG 0: 1
1: 0
2: 0
3: 13
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067135655 Original CRISPR CTGTTTGCGCAGATTAATCA GGG (reversed) Intergenic
No off target data available for this crispr