ID: 1067135659

View in Genome Browser
Species Human (GRCh38)
Location 10:43605480-43605502
Sequence AAACAGTGCTGAGAGGGAAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 487
Summary {0: 1, 1: 0, 2: 8, 3: 46, 4: 432}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067135653_1067135659 -4 Left 1067135653 10:43605461-43605483 CCCCCTGATTAATCTGCGCAAAC No data
Right 1067135659 10:43605480-43605502 AAACAGTGCTGAGAGGGAAGCGG 0: 1
1: 0
2: 8
3: 46
4: 432
1067135655_1067135659 -6 Left 1067135655 10:43605463-43605485 CCCTGATTAATCTGCGCAAACAG No data
Right 1067135659 10:43605480-43605502 AAACAGTGCTGAGAGGGAAGCGG 0: 1
1: 0
2: 8
3: 46
4: 432
1067135654_1067135659 -5 Left 1067135654 10:43605462-43605484 CCCCTGATTAATCTGCGCAAACA No data
Right 1067135659 10:43605480-43605502 AAACAGTGCTGAGAGGGAAGCGG 0: 1
1: 0
2: 8
3: 46
4: 432
1067135656_1067135659 -7 Left 1067135656 10:43605464-43605486 CCTGATTAATCTGCGCAAACAGT 0: 1
1: 2
2: 0
3: 3
4: 50
Right 1067135659 10:43605480-43605502 AAACAGTGCTGAGAGGGAAGCGG 0: 1
1: 0
2: 8
3: 46
4: 432

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067135659 Original CRISPR AAACAGTGCTGAGAGGGAAG CGG Intergenic
900157135 1:1207672-1207694 AGACACTGCAGAGAAGGAAGGGG + Intergenic
900189409 1:1346972-1346994 AGACAGTGCTGAGAGGTCTGCGG + Intronic
900405511 1:2491218-2491240 AAACACTGCTAAGAGGAAACTGG + Exonic
901105092 1:6749113-6749135 GAAAAGGGCAGAGAGGGAAGAGG - Intergenic
901121214 1:6895616-6895638 GAAGGGTGCTTAGAGGGAAGAGG - Intronic
901441190 1:9279491-9279513 AACCATGGCTGAGAGGGGAGAGG - Intergenic
901905992 1:12411523-12411545 AGAGAGAGATGAGAGGGAAGAGG + Intronic
902886327 1:19407518-19407540 GAGCAGTGCTGATAAGGAAGAGG + Intronic
902972419 1:20063408-20063430 AAACTGTGGGGAGAGGGATGGGG + Intronic
903787688 1:25872291-25872313 AAACAGGGCCAAGAGGGGAGGGG - Intergenic
904441252 1:30533437-30533459 GAAGAGTGCTGAGAGGCCAGGGG - Intergenic
904866097 1:33580046-33580068 AAAGAGTGCTGAAAGGGAACTGG + Intronic
905303977 1:37005039-37005061 AAACTGTCTTTAGAGGGAAGAGG - Intronic
905799602 1:40834775-40834797 AAACAGGGATGAGATGGAAAGGG - Intronic
906139077 1:43522713-43522735 AAAGAATGGGGAGAGGGAAGGGG + Intergenic
906228098 1:44138625-44138647 AAACAGGGGTGAGGGGCAAGTGG - Intergenic
906304660 1:44709261-44709283 ATACAGAGATGAGAAGGAAGAGG - Intronic
906326530 1:44849607-44849629 CAATAGGGCTGAGAGGGATGTGG - Intergenic
906610628 1:47199426-47199448 AAACAGTGCACAGAGAGAATTGG + Intergenic
906659828 1:47574260-47574282 GGACGGTGCTGAAAGGGAAGGGG + Intergenic
906914063 1:49989237-49989259 CAACAGAGCTGTGAGGAAAGGGG + Intronic
906952880 1:50348898-50348920 ATACAGAGATGACAGGGAAGAGG + Intergenic
908032006 1:60010928-60010950 AAGCAGTGGTGAGAGGCCAGTGG - Intronic
908933718 1:69347783-69347805 ACACAGTGCTGAGAGGCATTGGG + Intergenic
909089705 1:71210092-71210114 AAACAATGATGGGAGGGAAAGGG - Intergenic
909124953 1:71656152-71656174 TAACAGTGCAGATTGGGAAGTGG - Intronic
910373840 1:86548090-86548112 AAAAAGTGCTGACAAGGATGTGG - Intronic
911666868 1:100563358-100563380 AAACAGTACTGAGAGGCAGGAGG + Intergenic
911716554 1:101139874-101139896 AAAAAATGCAGTGAGGGAAGAGG + Intergenic
911831531 1:102555738-102555760 AAGTAGTGCAGATAGGGAAGAGG + Intergenic
912643287 1:111368206-111368228 CTAAAGTGCAGAGAGGGAAGTGG - Intergenic
912861424 1:113217183-113217205 AGACAGAGCCAAGAGGGAAGGGG - Intergenic
913076007 1:115340811-115340833 AAAAACAGCTGAGAGGGCAGCGG + Intergenic
913103512 1:115592051-115592073 TATCAGTGAAGAGAGGGAAGAGG - Intergenic
913963613 1:143357142-143357164 AAAGAGAGGAGAGAGGGAAGAGG - Intergenic
914057973 1:144182731-144182753 AAAGAGAGGAGAGAGGGAAGAGG - Intergenic
914121173 1:144783634-144783656 AAAGAGAGGAGAGAGGGAAGAGG + Intergenic
914218153 1:145653121-145653143 AAGCAGTGTTAAGAGGGAAATGG - Intronic
914470713 1:147975802-147975824 AAGCAGTGTTAAGAGGGAAATGG - Intronic
915331875 1:155117739-155117761 AGACAGTGCAGAGAGGGGTGGGG - Intergenic
915469181 1:156115453-156115475 AGACAGGACAGAGAGGGAAGTGG + Intronic
915576484 1:156782029-156782051 CAACAGGTCTGAGAGGGCAGGGG + Intronic
915608610 1:156971917-156971939 AAACAAAGATGAGAGAGAAGAGG + Intronic
915655255 1:157354002-157354024 AAACAGGGATGAGAGAGAATGGG - Intergenic
915840753 1:159211129-159211151 TCACAGTCCAGAGAGGGAAGAGG + Intergenic
917285382 1:173417078-173417100 TAACAGTACTAAGAGGTAAGTGG + Intergenic
918077979 1:181184806-181184828 AAGCAGTGCTGGGAGTGCAGAGG + Intergenic
919601513 1:199628823-199628845 AAAGAGAGCTGAGAGAGAAGGGG - Intergenic
920328490 1:205186311-205186333 AAACTGAGCTGAGAGAGAATGGG + Intronic
922979778 1:229815972-229815994 AAACCGGGCTGAGAGAGAACAGG - Intergenic
923056414 1:230429272-230429294 TGACAGAGCTGAGAGAGAAGTGG + Intergenic
923111168 1:230891475-230891497 ACACACTGAGGAGAGGGAAGTGG - Intergenic
923260871 1:232266716-232266738 AAATAGTGAAGGGAGGGAAGTGG + Intergenic
923450130 1:234109502-234109524 AAACAGTGATGAGATGGAAAGGG - Intronic
1063126047 10:3137528-3137550 AAACCGTCCTGAGAAGCAAGTGG - Intronic
1063143533 10:3276078-3276100 AAATTGGGCTGAGAAGGAAGAGG + Intergenic
1064227845 10:13503316-13503338 AAACAGTGCTGAAAGGAAGAGGG + Intronic
1064905710 10:20343395-20343417 AGACTGTGCAGAGAGGGAAATGG - Intergenic
1065234570 10:23636079-23636101 AAATAGAGCTGGGGGGGAAGTGG - Intergenic
1066248917 10:33614173-33614195 GAACAGTGATGAGATGAAAGGGG + Intergenic
1066598572 10:37079064-37079086 AAACAGTCCTGAAGGGGAAGAGG + Intergenic
1067135659 10:43605480-43605502 AAACAGTGCTGAGAGGGAAGCGG + Intergenic
1068091702 10:52440345-52440367 AAACAGTTCTGAGAGGGGCTGGG - Intergenic
1068830143 10:61484585-61484607 AAGCAGGGGTGGGAGGGAAGGGG + Intergenic
1069053610 10:63820495-63820517 AAACAGTTGAGAGAGAGAAGAGG - Intergenic
1069762565 10:70822581-70822603 AAACCATGCTGTGGGGGAAGGGG + Intronic
1069878321 10:71576540-71576562 AAACAGTGAGTGGAGGGAAGTGG + Intronic
1070016428 10:72537057-72537079 AAAAAATGGTGAGGGGGAAGGGG + Intronic
1070501512 10:77077048-77077070 AAAAAATGTTGAAAGGGAAGAGG + Intronic
1070739310 10:78892304-78892326 TCACAGTGGTGAGAGGGCAGTGG + Intergenic
1070765787 10:79055465-79055487 AAAAAGTGCAGTGAGTGAAGGGG + Intergenic
1070919821 10:80177519-80177541 AAACAAAGCTGAGAGAGAGGGGG - Intronic
1071015938 10:80997303-80997325 AAACTGTGCTGAGTGTAAAGTGG - Intergenic
1071255008 10:83864500-83864522 AAACAGTGGAGGAAGGGAAGAGG - Intergenic
1071711912 10:88058276-88058298 AAACAGTTGTTTGAGGGAAGGGG - Intergenic
1072490971 10:95905897-95905919 TAACAGTGAGGAGAGGGAAAAGG + Intronic
1072494147 10:95938044-95938066 AAATGTTGCTGAGAGTGAAGAGG + Exonic
1073458569 10:103652446-103652468 AAAAGATGCTGAGAGGGATGAGG + Intronic
1073962184 10:108945042-108945064 AAACAGTCCAGAGAGTCAAGAGG - Intergenic
1074353108 10:112757234-112757256 GATGAGTGCTGGGAGGGAAGAGG + Intronic
1074394607 10:113087340-113087362 ACACAATGCTGAGAGCAAAGAGG - Intronic
1074415122 10:113260943-113260965 AAACAGGGCTGCCAGGGAGGAGG + Intergenic
1076572700 10:131443010-131443032 AAACAGGACTGAGAGGGCCGAGG - Intergenic
1076595301 10:131621188-131621210 ACACTGTGCTGGGAGGGCAGGGG + Intergenic
1077922667 11:6653543-6653565 AAACAATGGTGTGAGGGATGTGG + Intronic
1078406292 11:11072740-11072762 AAAAAATGCTAAAAGGGAAGAGG + Intergenic
1078895542 11:15594047-15594069 AGACAGTGTTGAGAGCGAAAGGG + Intergenic
1079765744 11:24389751-24389773 ACACAGCACTGAGAGGAAAGTGG - Intergenic
1080688841 11:34538510-34538532 AAACAGGCCTGAGAGGGAATAGG - Intergenic
1081155072 11:39680208-39680230 AAACAGTTCTCAGTGGAAAGGGG + Intergenic
1081602036 11:44501948-44501970 AAACACTGATGAGGAGGAAGAGG + Intergenic
1082664074 11:55951463-55951485 ATAAAGTGATGAGAGGGAAATGG - Intergenic
1083047408 11:59749269-59749291 AAAGAGTGATGAGCAGGAAGGGG - Intronic
1083048965 11:59760077-59760099 AACCAGAGCTGAGAGTGATGGGG + Intronic
1083318757 11:61832452-61832474 AAGCAGTTCTGAGATGAAAGTGG + Intronic
1085204850 11:74725343-74725365 TAAAAGTGCTGAAAGGGAATTGG - Intronic
1085769308 11:79310736-79310758 AAACAGGACTCAGAGTGAAGGGG - Intronic
1085834234 11:79935287-79935309 AATCACTGCTGAAAGGGAAAGGG - Intergenic
1085891330 11:80582941-80582963 AAACAGTCCTGAAGGGGCAGAGG - Intergenic
1085938912 11:81185033-81185055 AGTCAGTGGTAAGAGGGAAGGGG - Intergenic
1086934379 11:92728788-92728810 AAACAGAGATTAGAGGGATGTGG - Intronic
1088153057 11:106771191-106771213 AAACACTGTTGATAGGGAAAGGG - Intronic
1088396560 11:109376252-109376274 ATGCAGTGATGGGAGGGAAGAGG + Intergenic
1088687724 11:112298742-112298764 ATCCAGTGGTGGGAGGGAAGGGG - Intergenic
1088899206 11:114102479-114102501 TAACAGTGGTTAGAGGGAGGAGG + Intronic
1089046268 11:115504111-115504133 ACTCAGGGCTGAGAGGGAAGGGG - Intronic
1089152228 11:116373048-116373070 CAACAGTGCTGAGAGGTGGGTGG - Intergenic
1089212679 11:116816564-116816586 AAACATCCCTAAGAGGGAAGGGG + Intergenic
1089296174 11:117469692-117469714 AACCAGGGAGGAGAGGGAAGTGG + Intronic
1089311658 11:117562061-117562083 AGACAGTGTTGAGAGGGAATAGG + Intronic
1089388157 11:118081312-118081334 AAACCCTGGTGATAGGGAAGGGG + Intronic
1090136530 11:124204830-124204852 AAAAAGTGCTGACAAGAAAGTGG + Intergenic
1090350667 11:126105830-126105852 ACACAGTTCTGAGAGAGAGGTGG - Intergenic
1090967660 11:131613104-131613126 AAAAAGTTCTGTAAGGGAAGTGG - Intronic
1091917149 12:4277896-4277918 AAACTGTGCTCAAAGGGAAACGG - Intronic
1093562626 12:20560499-20560521 AAACAGTTTTGAGAAAGAAGTGG + Intronic
1097263098 12:57730718-57730740 AAAGAGGGGTAAGAGGGAAGAGG - Intronic
1097682213 12:62659490-62659512 AGAATGTGCTGTGAGGGAAGAGG - Intronic
1098362570 12:69668979-69669001 AAGCAGACCTGAGAGGGATGGGG + Intronic
1099132000 12:78844514-78844536 AAACAGAGTTGATAGGGCAGTGG + Intergenic
1099165331 12:79299530-79299552 GCAAAGTGCTGAGAAGGAAGAGG + Exonic
1099935473 12:89119794-89119816 TTACAATGCTGAGAGGGAATGGG - Intergenic
1099972404 12:89514000-89514022 GAAAGGTGATGAGAGGGAAGAGG - Intronic
1101280191 12:103245902-103245924 ATACAGAGGTCAGAGGGAAGAGG + Intronic
1101494042 12:105236572-105236594 AAACAGCTCTGAGAGCAAAGAGG + Intronic
1101826242 12:108222350-108222372 AAACAGGGCTTCGAGAGAAGAGG - Intronic
1102155875 12:110727334-110727356 TTAAAGTGCTGAGAGGGAAAAGG - Intronic
1104148771 12:126061659-126061681 TAACTGTGCTGAGAGGAAAGAGG + Intergenic
1104536578 12:129623030-129623052 AATCAGAGCTGAGAGGGAGGGGG + Intronic
1104910931 12:132240648-132240670 AAACACGGCAGAGAGTGAAGAGG - Intronic
1105063532 12:133176266-133176288 AAGCAGTGCTAAGAGGGAAGTGG + Intronic
1105782075 13:23714488-23714510 AGAGGGTGCTGAGAGGGAGGGGG - Intergenic
1107635488 13:42388364-42388386 AAACAATGCAGAGATTGAAGTGG + Intergenic
1107813073 13:44218888-44218910 CAACAGTGCTGAGAAGGAGCTGG - Intergenic
1108429680 13:50341318-50341340 GAAAAGTGCTGAGGGGGAAAGGG - Intronic
1109076007 13:57835811-57835833 AAACATTGCTGAGATGGAATAGG + Intergenic
1109347822 13:61137632-61137654 ACACAGTGCTGGTAGGGATGAGG - Intergenic
1110408129 13:75173763-75173785 AAACAGTGCTGGTGGGGTAGAGG + Intergenic
1112806754 13:103171444-103171466 GAACAGTGCTGAAAGGAATGCGG - Intergenic
1114734528 14:25030374-25030396 AAAGGGTGCTGGGAAGGAAGTGG - Intronic
1116649225 14:47567688-47567710 AAACAGGGGTGTTAGGGAAGTGG - Intronic
1117068956 14:52039153-52039175 CCACAGTGCTGAGAGGGAGAAGG + Intronic
1118612919 14:67555454-67555476 ACCCAATGCTGAGAGGAAAGGGG + Intronic
1118639047 14:67775363-67775385 AAAAAATGCCCAGAGGGAAGTGG + Intronic
1119182164 14:72612584-72612606 AAACAGTGCAGGGAAGGGAGAGG + Intergenic
1119404575 14:74389741-74389763 AAACAGCGGTGAGTGGGCAGAGG + Intergenic
1120895942 14:89532483-89532505 AAACAGTTTGGAGAGGGAAGAGG - Intronic
1121029674 14:90647191-90647213 ATACAGTGGTAAGAGGGAAATGG - Intronic
1122002179 14:98667398-98667420 AAAGAGGGGAGAGAGGGAAGGGG - Intergenic
1122238037 14:100344071-100344093 AGACCGTGGGGAGAGGGAAGAGG - Intronic
1122468519 14:101950335-101950357 CAGCAGTGCAGAGAGGGAAAAGG + Intergenic
1122648921 14:103214426-103214448 AGACAGTGCAGAGTGGGGAGGGG + Intergenic
1123467329 15:20526773-20526795 AAACTGGGCTGAGAGGGAAGGGG + Intergenic
1123650785 15:22474269-22474291 AAACTGGGCTGAGAGGGAAGGGG - Intergenic
1123741193 15:23283111-23283133 AAACTGGGCTGAGAGGGAAGGGG - Intergenic
1123745804 15:23319447-23319469 AAACTGGGCTGAGAGGGAAGGGG + Intergenic
1123787217 15:23686263-23686285 AGACACTGCTGCGAGGGTAGTGG + Exonic
1124278076 15:28342764-28342786 AAACTGGGCTGAGAGGGAAGGGG + Intergenic
1124304627 15:28568844-28568866 AAACTGGGCTGAGAGGGAAGGGG - Intergenic
1124533514 15:30525303-30525325 AAACAAGGCTGAGAGAGAAGGGG - Intergenic
1124765144 15:32482342-32482364 AAACAAGGCTGAGAGGGAAGGGG + Intergenic
1124877267 15:33606812-33606834 AAAAAGTGGTTAAAGGGAAGGGG - Intronic
1125193897 15:37024354-37024376 AGACAGTGCAGAGAGAGAACGGG - Intronic
1125292860 15:38168829-38168851 AAGCAGTGCTGAGCAGGAGGAGG + Intergenic
1126338462 15:47613292-47613314 AAACAGTGCTGAAAATGCAGTGG - Intronic
1127185944 15:56480892-56480914 AAAGAATGGTCAGAGGGAAGAGG - Intergenic
1128390415 15:67179091-67179113 AAACAGCGCCGAGAGTAAAGAGG + Intronic
1128419643 15:67479407-67479429 AAACAGTCCTTAGGGGGAAAAGG - Intronic
1128632156 15:69278609-69278631 GAGCTGTGGTGAGAGGGAAGGGG + Intergenic
1129611620 15:77064147-77064169 AGACAGTGAGGAGAAGGAAGAGG + Intronic
1129989294 15:79948239-79948261 AAACAGTGCTGTGACAGAGGAGG - Intergenic
1131161293 15:90106641-90106663 CAACAGTGGTGAGAGGGTATTGG + Intergenic
1131550415 15:93352258-93352280 AGAAAGTGCAGAAAGGGAAGAGG - Intergenic
1131849919 15:96527921-96527943 AAGCAGTGCAAAGATGGAAGGGG - Intergenic
1133258225 16:4531722-4531744 AAACAGGGCTGACAGTGATGTGG - Intronic
1133494994 16:6309480-6309502 AATTATTGCTGACAGGGAAGCGG + Intronic
1135769880 16:25209420-25209442 ATACAGTGCTGACAAAGAAGGGG - Intergenic
1137483491 16:48872166-48872188 AAACAGGGCAGGGAGGGAGGGGG - Intergenic
1137633733 16:49967413-49967435 GAACACAGCTGAGAGGGCAGGGG + Intergenic
1138003544 16:53307718-53307740 AAACAGTTCTGAAAGGAAAGTGG + Exonic
1140493540 16:75362332-75362354 ACACTGTGCTGAAAGGCAAGGGG + Intronic
1140699594 16:77569000-77569022 AACCAGAGCAGACAGGGAAGGGG - Intergenic
1141014177 16:80432594-80432616 GAGCAGTGGTGAGAGGGAGGTGG + Intergenic
1141220892 16:82068465-82068487 AAACAGTGCCCAGAGTGGAGTGG - Intronic
1142190267 16:88714201-88714223 ACACAGTGCTGACAGTGGAGGGG - Exonic
1142905046 17:3035706-3035728 GGGCAGTGCTGAGAGGGAGGAGG + Exonic
1142934004 17:3311900-3311922 AAAGGGTGCTGACAGGGAAGAGG + Intergenic
1143002496 17:3803605-3803627 AAACAGGGGTGAGGGAGAAGAGG + Intergenic
1143563593 17:7708944-7708966 AATCAGTGCTGTCAGAGAAGTGG + Intronic
1144035287 17:11359755-11359777 AAACAGTTCTCACCGGGAAGTGG + Intronic
1145193910 17:20869818-20869840 AAAGGGTGGTGAGAGGGAGGGGG + Intronic
1145298125 17:21611353-21611375 AAAGGGTGGTGAGAGGGAGGGGG - Intergenic
1145352132 17:22092047-22092069 AAAGGGTGGTGAGAGGGAGGGGG + Intergenic
1146129330 17:30257724-30257746 CAACAATGCTGTGAGGAAAGAGG + Intronic
1146155651 17:30522139-30522161 AAACAGTGATGAAAGGCATGGGG - Intronic
1146478350 17:33181216-33181238 ACAAAGTGCTGAGAGGGTAAAGG - Intronic
1146512007 17:33458003-33458025 ACAAAGTGCTGTGGGGGAAGGGG + Intronic
1147188533 17:38725791-38725813 GGACAGTGCGGAAAGGGAAGGGG - Exonic
1147539339 17:41343926-41343948 AAACAGTGCTCTGAGGGGAGAGG - Intergenic
1148083820 17:44982277-44982299 TAACAGTGGTGTGATGGAAGTGG + Intergenic
1148678675 17:49460177-49460199 AAACAGTGCTGAGGAGAAACAGG - Intronic
1148742033 17:49898406-49898428 CAGCAGGGCTGGGAGGGAAGAGG - Intergenic
1149243222 17:54675452-54675474 AATCATGGCTGAAAGGGAAGGGG + Intergenic
1149557201 17:57582001-57582023 ACACAGTGCTGAGAGGCATTGGG - Intronic
1149621165 17:58046364-58046386 AAACATTGCAGAGAGGGGAGAGG + Intergenic
1150571039 17:66387546-66387568 CTACAGGGCTGAGAGGGGAGGGG + Intronic
1150657705 17:67051229-67051251 GAACAGGGCAGGGAGGGAAGGGG + Intronic
1151215107 17:72571776-72571798 GAACAGGGCTGATAAGGAAGTGG + Intergenic
1153250764 18:3119268-3119290 AGTCAGTGCAGAGAGGCAAGCGG + Intronic
1153474551 18:5484341-5484363 AAGCAGTACTAAGAGGGAAGTGG + Intronic
1155570899 18:27192556-27192578 AAACAGTGTTCAGAGGTAATAGG - Intergenic
1156018055 18:32568363-32568385 AAAGAAAGCTGAGAGGGAAGGGG + Intergenic
1156109258 18:33703671-33703693 AAAAAGTGAGGAGAGGGATGGGG - Intronic
1156438272 18:37156923-37156945 AGAAAGTACTAAGAGGGAAGAGG + Intronic
1156686850 18:39660358-39660380 CAACAGTGCTCTGAGGGAACTGG - Intergenic
1156744474 18:40372234-40372256 AGACAGTGCAAAGAGGGGAGGGG - Intergenic
1157186078 18:45540958-45540980 AGAGGGTGATGAGAGGGAAGGGG + Intronic
1157315826 18:46588912-46588934 CAACAGTGCTGGGAGGGCAGGGG + Intronic
1157347637 18:46853946-46853968 AGACAGTCCTGGGAGTGAAGGGG - Intronic
1159140014 18:64382136-64382158 AAAGAGTGGTGAGTGAGAAGAGG - Intergenic
1161162336 19:2768305-2768327 ACACAGTGCTGGGCAGGAAGTGG - Intronic
1161237500 19:3205136-3205158 ACACAGTGCCCAGAGGGAGGCGG - Intronic
1161657305 19:5524195-5524217 ACACAGAGGTGAGAGAGAAGAGG - Intergenic
1162625483 19:11881330-11881352 AAACAAACCTGCGAGGGAAGCGG + Intronic
1164519065 19:28963654-28963676 AAACAGTGTTGAATGGGAGGAGG + Intergenic
1165209604 19:34223432-34223454 AAACAGTGCAGATAGAGATGCGG - Intronic
1167349663 19:48966568-48966590 TCACAGAGCTGAGAGAGAAGAGG - Exonic
1167604966 19:50476748-50476770 GCGCAGGGCTGAGAGGGAAGAGG + Intronic
1168334734 19:55591409-55591431 AAACACTGGGGAGAGGGACGAGG + Exonic
1168585273 19:57586651-57586673 AAACAGTTGTGAGAGAAAAGTGG + Intronic
1202697456 1_KI270712v1_random:135399-135421 AAAGAGAGGAGAGAGGGAAGAGG - Intergenic
925243686 2:2359227-2359249 AAGCACTGCAGAGAGAGAAGTGG - Intergenic
925924779 2:8662173-8662195 ACAGAGTGCTAAGAAGGAAGCGG - Intergenic
925970792 2:9105328-9105350 ATGCTGTGCTGAGATGGAAGCGG - Intergenic
926808273 2:16733416-16733438 AAACCGTGCTGAGAGTTAATTGG + Intergenic
927611344 2:24544388-24544410 AAAATGTGCGGAGATGGAAGAGG + Intronic
927785039 2:25968046-25968068 AAATAGGTCTGTGAGGGAAGGGG - Intronic
928952152 2:36822805-36822827 AAACAGGGCTGAGAGAAAAGTGG - Intergenic
931556059 2:63506830-63506852 AAACATTGCTGAGAGTGAGAAGG + Intronic
931827568 2:66017516-66017538 AAACACTGCTGAGAAAGGAGGGG + Intergenic
932368214 2:71166620-71166642 AAACTGGGCCTAGAGGGAAGGGG - Intergenic
932609010 2:73184786-73184808 GAAGGGTGCTGAGAGAGAAGGGG + Intergenic
932621106 2:73265396-73265418 ACACAGCACTGAGGGGGAAGAGG - Exonic
933166860 2:79086314-79086336 AAACATTTTTGAGAGGTAAGAGG - Intronic
933577536 2:84086734-84086756 AAACAGTGATGTCAGGGAAATGG - Intergenic
933625034 2:84588493-84588515 AAACAGGGAAGAGAAGGAAGGGG - Intronic
933915891 2:86993162-86993184 AAAGATTGCTGAGAGGAAACTGG - Intronic
934007102 2:87776740-87776762 AAAGACTGCTGAGAGGAAACTGG + Intronic
934278626 2:91592423-91592445 AAAGAGAGGAGAGAGGGAAGAGG - Intergenic
934959332 2:98655151-98655173 TGACAGTGGAGAGAGGGAAGAGG + Intronic
935585989 2:104800862-104800884 GAACACTGCTGAGATGGAGGGGG - Intergenic
936242634 2:110801116-110801138 AAGCAGTGCGGAGTGGGGAGGGG - Intronic
937081259 2:119141693-119141715 AGAAAGAGCTGACAGGGAAGTGG - Intergenic
937292751 2:120791373-120791395 AGACAGTGGTGTGAGGGGAGAGG + Intronic
938200397 2:129367934-129367956 CAACACTGCTAAAAGGGAAGAGG + Intergenic
938409957 2:131055518-131055540 ACACACTGCTGTGTGGGAAGGGG - Intronic
938669533 2:133573748-133573770 AAAAAGTGCTGAGACAGAGGAGG + Intergenic
939412071 2:141840598-141840620 AAACAGTACTGGGCTGGAAGCGG - Intronic
940390731 2:153129940-153129962 AAAATGTGCAGAGAGGAAAGAGG + Intergenic
940660633 2:156540701-156540723 AAACAGTGTTGATAGGAAAATGG - Intronic
940986814 2:160059160-160059182 AGACAGTAATGTGAGGGAAGGGG + Intronic
942775208 2:179572821-179572843 AAACAGGGCTTAGTGGGAAGGGG - Intronic
943263907 2:185700962-185700984 AAACAGAGTTGAGAGGCCAGTGG + Intergenic
944546616 2:200805201-200805223 CCACAGGGCTGAGAAGGAAGGGG - Intergenic
944978109 2:205080979-205081001 ACACAGTGATGAGAGAGAGGAGG - Intronic
945452134 2:210005752-210005774 AAACAGAGCAGATAGGGAAAGGG - Intronic
946156251 2:217808634-217808656 TGACAGTGTTGAGAGGGTAGTGG + Exonic
946598336 2:221331513-221331535 AAACAGTGCAGGGAGAGAAAGGG + Intergenic
946631840 2:221677835-221677857 AAACTCTGCTGAGGGGGCAGGGG - Intergenic
947820742 2:233067677-233067699 AACAAGTGCTGGTAGGGAAGTGG - Intronic
948113874 2:235479431-235479453 AAACACTGCTGAAAGCCAAGTGG + Intergenic
948421787 2:237864467-237864489 AGACAGTTGTGAGAGGGAAGCGG + Intronic
1168848182 20:959387-959409 AAACAGGTCTGAGAAGGAAGGGG - Exonic
1168905823 20:1402990-1403012 AAACATAGCTGAGATGGATGGGG + Intergenic
1169244990 20:4018121-4018143 GCCTAGTGCTGAGAGGGAAGTGG - Intergenic
1170033370 20:11965731-11965753 AAACAGTGCTGGGAGGATATGGG + Intergenic
1170089191 20:12571514-12571536 AAATAGAGGTGAGAGGGAAGGGG - Intergenic
1170927956 20:20742918-20742940 AATCAGTGTTGAGAGGTAAGGGG + Intergenic
1171385752 20:24768394-24768416 ACACATTGTTGAGTGGGAAGGGG - Intergenic
1171403657 20:24895055-24895077 AAACAGAGTTGAGAGGCCAGGGG + Intergenic
1171562469 20:26137331-26137353 AAAGGGTGGTGAGAGGGAGGGGG + Intergenic
1172300000 20:33842711-33842733 GTACAGGGCTGGGAGGGAAGAGG - Intronic
1172510817 20:35499750-35499772 TAGGAGTGTTGAGAGGGAAGTGG + Intronic
1172688986 20:36777749-36777771 AAACCAGGCTGAGTGGGAAGGGG + Exonic
1173698994 20:45049911-45049933 GAACAGTGTAGAGAGGGGAGGGG - Intronic
1173713046 20:45176938-45176960 AAACATTAATGAGAAGGAAGTGG - Intergenic
1174951932 20:55051536-55051558 AAACAGAGGGGAGAGGGGAGAGG + Intergenic
1175156181 20:56973132-56973154 AGACAGTGCTGAGACTGCAGGGG - Intergenic
1175405307 20:58722252-58722274 AAGCCGAGCTGAGAGGGCAGAGG - Intergenic
1175994419 20:62805699-62805721 AAACAGTGCTGGGTGCCAAGGGG - Intronic
1176273172 20:64247046-64247068 AAACAGTGCTGAGTGGAGGGAGG + Intergenic
1176648878 21:9528312-9528334 AAAGAGTGGTGAGAGGGAGGGGG - Intergenic
1178800552 21:35790940-35790962 AAACAGTGTTGAAAAGGAACAGG - Intronic
1179486515 21:41713988-41714010 AGACAGGGGTGAGGGGGAAGAGG + Intergenic
1181809601 22:25395365-25395387 CTACAGTGCTGAGAAGGAACAGG + Intronic
1182335379 22:29580492-29580514 AAACGGACCTGAGAGGGAATGGG - Intronic
1182822100 22:33225278-33225300 AACTAGTGCCGAGAGGGCAGTGG - Intronic
1182948451 22:34347933-34347955 GAACAGGGTGGAGAGGGAAGAGG + Intergenic
1183431158 22:37766521-37766543 AGACTCTGCTGAGGGGGAAGGGG - Intronic
1184431192 22:44442309-44442331 AGACATTGCTGAGATGGGAGTGG + Intergenic
1184841401 22:47054441-47054463 AAGCAGGGCAGAGTGGGAAGTGG - Intronic
949905196 3:8853093-8853115 TCACAGTGCTGAGAGGTAACGGG + Intronic
950119107 3:10470085-10470107 AAACAGACCTGGGAGGGAAAAGG + Intronic
950491037 3:13305268-13305290 AAACGGGGAAGAGAGGGAAGGGG + Intergenic
950640353 3:14344534-14344556 AGACACTGCTGAAAGGGAGGAGG + Intergenic
951997496 3:28747364-28747386 AACCAGGGCTGAGAGACAAGGGG - Intergenic
952610144 3:35198978-35199000 AAACCATGCTAAGAGGGAATGGG - Intergenic
952752133 3:36833255-36833277 CAACAATGCTGAGAAGGAAATGG - Exonic
953356672 3:42262186-42262208 AAACACTGCTGGAAGGGATGTGG - Intronic
953771434 3:45780869-45780891 AACCAGTGCTCAGAGTGGAGTGG - Intronic
953861502 3:46547767-46547789 AGAAAGTGCTGAAAGAGAAGTGG + Intronic
953982843 3:47421246-47421268 AGAAAGGGCTGAAAGGGAAGGGG + Intronic
955761194 3:62284936-62284958 AAAGGGTGCTCAGAGGAAAGAGG - Intronic
956613457 3:71147413-71147435 GAACAGCCCTGAGAGGGAAGGGG - Intronic
957146770 3:76434752-76434774 AAACAGGGCTGAGCAGGAAGCGG - Intronic
959206932 3:103320356-103320378 AAAAAATGCTGGGAGGGAAAAGG + Intergenic
959646374 3:108707844-108707866 AAGCTGTGCTGTGTGGGAAGAGG + Intergenic
959908914 3:111740916-111740938 AAACAGTGGGGAGAGGAGAGGGG + Intronic
960615284 3:119590855-119590877 AAGCAGTGGTGAGGGGGAGGAGG - Intergenic
961647089 3:128398359-128398381 GGGCAGTGCTGAGATGGAAGAGG + Intronic
962370724 3:134818909-134818931 ACACAGTCCTGAAAGGGGAGGGG - Intronic
962715900 3:138125884-138125906 AAGCAGAGCTGAGAAGGGAGTGG + Intronic
962731767 3:138290100-138290122 AAAAAGTGCTGGGAGGACAGAGG + Intronic
963938372 3:151077042-151077064 AAGCAGTGCTCCAAGGGAAGAGG - Intergenic
964612334 3:158627765-158627787 AAACATTCCCGAGAGGGAAGTGG - Intergenic
966165619 3:177013417-177013439 AAACAGAGCTGAGGGGGAAACGG + Intergenic
966394103 3:179483941-179483963 AAACAGCTTTGAGAGGGAATGGG - Intergenic
966780225 3:183578125-183578147 AGAAAATGCTTAGAGGGAAGAGG + Intergenic
968095979 3:195931196-195931218 AAAAGGTGGTGAGAGGAAAGTGG + Intergenic
970675235 4:18441368-18441390 AACCAGTGATCAGAGGGAGGAGG + Intergenic
971238143 4:24862504-24862526 AGGCAGTGATGAGAGAGAAGGGG - Intronic
971619296 4:28834028-28834050 AAACAATGCTTAGAAAGAAGAGG - Intergenic
971845307 4:31911468-31911490 AAACAATGCTGATATGGATGTGG - Intergenic
972145837 4:36023744-36023766 AGACAGTGCTGAAAAGCAAGCGG + Intronic
972283510 4:37626078-37626100 AAAAAGTGCTGATGGGGATGTGG + Intronic
972418064 4:38862164-38862186 ACCCAGTGCTCAGTGGGAAGGGG - Intergenic
973940244 4:55901389-55901411 AAAAAGTAATGAGAGGGAATGGG + Intronic
974020406 4:56687827-56687849 AAACACTGTTGAGAGGGTTGTGG - Intergenic
975486803 4:74942771-74942793 AAACAGACCTAAGAGGGGAGGGG - Intronic
975717848 4:77222390-77222412 AAACAGTGCTTACAGAGAACAGG - Intronic
979312633 4:119221686-119221708 CAACAGGGCAGAGAGAGAAGGGG + Intronic
979559278 4:122083836-122083858 GAACACTGCTAAGAGGGAGGGGG + Intergenic
981062265 4:140437418-140437440 AAACAAGGGTGAGGGGGAAGTGG + Intergenic
981397188 4:144266266-144266288 AACCTGAGCTGAGAGGAAAGTGG - Intergenic
984406068 4:179331611-179331633 AAGCAGTGTTGATAGGGAAGAGG - Intergenic
984926923 4:184815254-184815276 AGACAGTGCTGTGAGCAAAGAGG + Intronic
986327329 5:6686034-6686056 GCACAGTGCTGGGAGGGACGGGG + Intergenic
986699577 5:10392815-10392837 AAACTGTGGTGGGAGGGAGGAGG - Intronic
987449858 5:18069325-18069347 AATCCATGGTGAGAGGGAAGGGG - Intergenic
987971792 5:24955701-24955723 AAACATGGCTGAAGGGGAAGGGG - Intergenic
988693032 5:33591810-33591832 AATCAGTGGTGACAGGGAAAGGG + Intronic
988731351 5:33976177-33976199 ACCAAGTGCTGATAGGGAAGGGG + Intronic
989498644 5:42139786-42139808 TGACAGCGCTGATAGGGAAGAGG - Intergenic
990244205 5:53847361-53847383 AATCAGTGCTAAGAGGGAAATGG + Intergenic
990534161 5:56703827-56703849 AAAAAGAGATGGGAGGGAAGTGG - Intergenic
991012872 5:61901977-61901999 AAGCAATGCTGTGAGGGAAATGG - Intergenic
991225841 5:64270549-64270571 CAACAGTTCTGTGAGGGAAGTGG + Intronic
991294487 5:65066037-65066059 CAACTCTGCTGAGGGGGAAGGGG - Intergenic
991411605 5:66351662-66351684 ACCAAGTGCTGAGAGGGGAGGGG - Intergenic
992096252 5:73365878-73365900 AACCAGTTCTGAGAAGGAAAGGG - Intergenic
992549571 5:77847873-77847895 AAACAGGGCTGACAGAGAGGGGG + Intronic
993727908 5:91389425-91389447 AAACAGTACTGAGAAGTTAGTGG - Intergenic
994070776 5:95599466-95599488 AAAGAAGGCTGTGAGGGAAGAGG - Intronic
995357489 5:111255805-111255827 AAACAGTGGTGAGCAGGAAATGG - Intronic
996057564 5:118998505-118998527 AGACCGTGCGGAGAGGGAGGCGG - Intergenic
997438188 5:133890195-133890217 AAACAGTATTGTAAGGGAAGTGG + Intergenic
997867888 5:137480877-137480899 AAAGAATGAGGAGAGGGAAGAGG + Intronic
998595876 5:143529812-143529834 AAACAGTGCTGAGAAAGAGAAGG + Intergenic
998783292 5:145682164-145682186 AAAAAGTGGGGAGAGGGAGGAGG + Intronic
999455821 5:151714853-151714875 AAACCGTGGGGAGAGGGAGGGGG + Intergenic
999497619 5:152115553-152115575 ACACAGTCCTGAGATGGCAGTGG - Intergenic
999993014 5:157066071-157066093 AAAAAATGCTGAGGTGGAAGAGG + Intergenic
1000046768 5:157528316-157528338 CAGCAGTGCTGAAAGGGAGGGGG - Intronic
1000369385 5:160520163-160520185 AAAAAGTGCAGACAGGGAAGGGG + Intergenic
1000869618 5:166559779-166559801 AAACAGTTTTTAGTGGGAAGGGG + Intergenic
1001141681 5:169149596-169149618 GAACAGTGGTGAAAGTGAAGAGG + Intronic
1001397692 5:171428783-171428805 AAACAGGGATCAGTGGGAAGAGG + Intronic
1001784613 5:174401369-174401391 AAACACTTCTGAGAGGGAAAGGG - Intergenic
1001806888 5:174594369-174594391 ACACAGAGCTAAGAGGGAATAGG + Intergenic
1003146712 6:3516144-3516166 AAACAATGCTGAGAAGGCACAGG + Intergenic
1003371771 6:5535009-5535031 AAAAAGTGTTGAGAAGGATGTGG - Intronic
1003986990 6:11445737-11445759 AAAAAGTGTAAAGAGGGAAGTGG - Intergenic
1003996731 6:11549084-11549106 AAAGAGTGGTCAGAGGTAAGAGG + Intronic
1005496517 6:26392595-26392617 ACACAGTGTTGAGAGGAAAGGGG + Exonic
1005505818 6:26468177-26468199 AGACAGTGTTGAGAGGAAAGGGG + Exonic
1005944465 6:30585390-30585412 AAACAGGGCAGGGAGGGAAGGGG - Intronic
1006024764 6:31139742-31139764 AAACAGCTCTGGGTGGGAAGAGG - Exonic
1006333390 6:33407942-33407964 AATCAGTGCTGACTGGGAGGAGG - Intronic
1006771509 6:36557285-36557307 AAACTGTACAGAGAGGGAAGGGG - Intergenic
1007313715 6:40967275-40967297 AAACATGGCTCAGAGGAAAGTGG + Intergenic
1007387209 6:41528097-41528119 AAACTGGGCGGGGAGGGAAGTGG - Intergenic
1007507060 6:42343863-42343885 CTACAGTGCTAAGAGGGTAGGGG + Intronic
1007945906 6:45827045-45827067 AGTCAGTGCTCAGAGGAAAGGGG - Intergenic
1008790225 6:55222313-55222335 AAAAAGTGTTGAAAGGGATGTGG + Intronic
1009269017 6:61595039-61595061 AAACAGTGGGGAGAGAGAAAAGG - Intergenic
1009547443 6:65038265-65038287 TAACAGTGTTGATTGGGAAGGGG - Intronic
1009871351 6:69455958-69455980 AAACTATGCAGAGAGGAAAGAGG + Intergenic
1013036763 6:106392511-106392533 GGACAGTGCTAAGAGGGGAGTGG + Intergenic
1013942377 6:115680359-115680381 AAACATTGCACACAGGGAAGTGG - Intergenic
1015004552 6:128263228-128263250 AAAAAGTCCTAAGAAGGAAGAGG + Intronic
1015297409 6:131612803-131612825 AAATAGTGCTGGGAAGGAATTGG - Intronic
1015421007 6:133008293-133008315 AAACAGGGCTGGGTGGGCAGGGG + Intergenic
1016038449 6:139407200-139407222 AAGCAGGGTTGAGAAGGAAGAGG - Intergenic
1017314727 6:153017360-153017382 AAAAAGTCATGAGAGCGAAGTGG + Intronic
1017878653 6:158544536-158544558 GAACAGTGCAGAAAGGGACGGGG + Intronic
1017899888 6:158710616-158710638 AAACTGTGCTGTGTGTGAAGGGG + Intronic
1019094623 6:169568827-169568849 AAACAGAACTGAGAGGAAATGGG + Intronic
1019311947 7:366995-367017 AAACAGTCGGCAGAGGGAAGAGG + Intergenic
1019589078 7:1820277-1820299 AGGCAGTGCTTAGAGGGAAACGG + Intronic
1020814101 7:12883142-12883164 AAAAAATGCTGAGAGGGAGTAGG - Intergenic
1020911832 7:14140832-14140854 AAACACAGCTCAGAGGCAAGTGG - Intergenic
1022096498 7:27144777-27144799 AAATATAGCTGAGAGGCAAGTGG + Intronic
1022607500 7:31830209-31830231 AAACAGTGCTGATAATGTAGAGG + Intronic
1023125424 7:36950055-36950077 AAAAAGTGGTGAGTGAGAAGGGG - Intronic
1023246094 7:38205819-38205841 AAACAGTGATTAGAAGGCAGAGG - Intronic
1023653064 7:42390676-42390698 AACCAGTGCTAACAGGGAGGAGG + Intergenic
1023796339 7:43795554-43795576 AAGCAGTACTAAGAGAGAAGTGG + Intronic
1023876417 7:44288725-44288747 AACCTGTCCTGAGAGAGAAGGGG + Intronic
1024389140 7:48787045-48787067 AAGCAGGGCAGAGTGGGAAGTGG + Intergenic
1025275390 7:57578383-57578405 AAAGGGTGGTGAGAGGGAGGGGG - Intergenic
1025966944 7:66282248-66282270 ACACAGTGATTAGAGGGAAATGG - Intronic
1028896185 7:96044760-96044782 ATACTCTGCTGAGTGGGAAGTGG + Intronic
1029100160 7:98122899-98122921 AAACAGAGCTGATAGGAAACAGG - Intronic
1029383264 7:100226945-100226967 AAACATGGCTGTGGGGGAAGAGG + Intronic
1029490547 7:100867893-100867915 TAACACTGCTCAGATGGAAGGGG - Exonic
1029867594 7:103651683-103651705 AGACAGTGCTGTGGGGGAGGTGG + Exonic
1030511396 7:110486809-110486831 CAACAGTGGTATGAGGGAAGAGG - Intergenic
1030569348 7:111202794-111202816 AAACAGAGATGAGTGTGAAGGGG + Intronic
1030797813 7:113810499-113810521 AAACAGGCCAGAGAAGGAAGGGG + Intergenic
1031909936 7:127505437-127505459 AAACAGCTGGGAGAGGGAAGGGG - Intergenic
1033264136 7:139869902-139869924 CAAGAGTGCAGAGAAGGAAGTGG + Intronic
1033515133 7:142097823-142097845 CAACAGTTCTATGAGGGAAGTGG - Intronic
1035141754 7:156769434-156769456 ACTCAGTGGTGAGAGGGAGGCGG - Intronic
1035225859 7:157431836-157431858 AAAGAGGGCTGAAAGGGAACAGG - Intergenic
1035348585 7:158226512-158226534 ACAGACTGCTGAGAGGGAAACGG + Intronic
1035775563 8:2185061-2185083 AAACAGGGAAAAGAGGGAAGAGG + Intergenic
1036038041 8:5041645-5041667 AATCAGAGCTGGGAGGAAAGGGG - Intergenic
1037393363 8:18417566-18417588 AAACAGTGCTGAAGGGGAAAGGG - Intergenic
1037738321 8:21584198-21584220 AAACAGTTCTAAAAGGGAATGGG + Intergenic
1037739248 8:21592246-21592268 AAACATTTCAGAGAGGAAAGAGG + Intergenic
1038973381 8:32663202-32663224 AAAGTGAGCTGAGAGGGATGGGG - Intronic
1039212407 8:35232887-35232909 AAACAGTTCTGAGGAGGATGAGG + Intergenic
1039243329 8:35580909-35580931 AAAAAGTGTAGAGAGGGAATAGG + Intronic
1040110256 8:43564059-43564081 AAAAAGTGGTGAGACCGAAGAGG - Intergenic
1041562205 8:59231322-59231344 AAACATTTCTAAAAGGGAAGAGG + Intergenic
1042729495 8:71916012-71916034 AAATGGTGCTGAAAAGGAAGGGG - Intronic
1045100282 8:98837209-98837231 AAGCAGTTCTGAGAGGGCAAGGG - Intronic
1045642960 8:104272246-104272268 AATGAGTACTGACAGGGAAGCGG + Intergenic
1045654967 8:104377200-104377222 AAACAGTGGGGGGAGGGGAGAGG + Intronic
1047281603 8:123450784-123450806 AAACACTGCAAAGTGGGAAGAGG - Intronic
1047536908 8:125728309-125728331 CATCAGTGCTTAGACGGAAGTGG + Intergenic
1048029270 8:130615706-130615728 CAGCAGAGCTGAGAGGGAAAAGG - Intergenic
1049658327 8:143808665-143808687 AAACAGGGCTGAAGAGGAAGAGG - Exonic
1049832771 8:144712930-144712952 AGACAGTGTTGAGTGAGAAGCGG - Intergenic
1050420149 9:5455484-5455506 TAACAGTGGGGAGTGGGAAGGGG - Intronic
1053015273 9:34658404-34658426 AGACACTCCTGAGAGGGGAGGGG - Intronic
1053184202 9:36001499-36001521 GAACAGTGATGAGAGGGTAGAGG + Intergenic
1055355993 9:75437465-75437487 AAATAGTTCTGAGAGAGAAAGGG - Intergenic
1055800265 9:80027637-80027659 AGACCTTGCTGAGGGGGAAGGGG - Intergenic
1056456356 9:86764639-86764661 AAACACTGCTGAGCAGGAGGCGG - Intergenic
1056600603 9:88043865-88043887 AAACATTCCCAAGAGGGAAGTGG - Intergenic
1056682698 9:88732972-88732994 AAGCAGTGGTGAGATGGAAGGGG + Intergenic
1056869393 9:90263417-90263439 AAACAATGCAGAGAGAGATGAGG - Intergenic
1057605315 9:96494677-96494699 AAAGAGTGCTCAGATGGCAGTGG - Intronic
1058663225 9:107284213-107284235 AAACAATTCTGAGGGGAAAGGGG - Intronic
1059079472 9:111233241-111233263 AAACAGTGGTGTGAGTGCAGTGG - Intergenic
1059099564 9:111456830-111456852 AAAAAGAGTGGAGAGGGAAGAGG + Intronic
1059648931 9:116296427-116296449 TAACAGTGCTCAGAGTAAAGGGG - Intronic
1060302681 9:122384454-122384476 GAACAGTCATTAGAGGGAAGAGG + Intronic
1060464073 9:123887204-123887226 AAACTGTTCAGAAAGGGAAGGGG - Intronic
1060880382 9:127113865-127113887 CCACAGTGGTGAGAGGGATGCGG - Intronic
1061004354 9:127920165-127920187 AAAGATGGCTGAGGGGGAAGGGG - Intergenic
1061077006 9:128347909-128347931 AAATGGTGCTGAAAGGGGAGAGG + Intronic
1062552904 9:137098268-137098290 AAACGGTGCTGAGAATGAAGTGG - Intronic
1203626614 Un_KI270750v1:31861-31883 AAAGAGTGGTGAGAGGGAGGGGG - Intergenic
1186509735 X:10121686-10121708 GAAAAGTGCGGAGATGGAAGCGG + Intronic
1188535709 X:31194547-31194569 AAACAGAGCTGAGAGGGTGGAGG + Intronic
1189896377 X:45660603-45660625 GAGCAGGACTGAGAGGGAAGGGG - Intergenic
1190961122 X:55249173-55249195 AACAAGTGCTGACAGGGATGTGG + Intronic
1192358286 X:70423337-70423359 AAGCAGTGCAGAGAGGAGAGCGG + Exonic
1192590472 X:72355425-72355447 AAGAAGTGCTGAGGGGGAAAGGG - Intronic
1193681923 X:84532077-84532099 AAAGAGTAGTGGGAGGGAAGGGG - Intergenic
1194735468 X:97507859-97507881 AGAGAGTGCTGAGAGGAGAGTGG + Intronic
1194799473 X:98254209-98254231 AAAAAGTGTTGATAGAGAAGTGG - Intergenic
1196066969 X:111474393-111474415 AAAAGGTGCAGAAAGGGAAGTGG - Intergenic
1197969538 X:132100812-132100834 AAACAGTGCTTAAAGGAAACAGG - Intronic
1200325260 X:155231210-155231232 AATGAGTGCTGAGAGGGAGTAGG - Intronic