ID: 1067135661

View in Genome Browser
Species Human (GRCh38)
Location 10:43605514-43605536
Sequence CCTGAACTGACAGAGACTAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 158}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067135655_1067135661 28 Left 1067135655 10:43605463-43605485 CCCTGATTAATCTGCGCAAACAG No data
Right 1067135661 10:43605514-43605536 CCTGAACTGACAGAGACTAGTGG 0: 1
1: 0
2: 0
3: 13
4: 158
1067135653_1067135661 30 Left 1067135653 10:43605461-43605483 CCCCCTGATTAATCTGCGCAAAC No data
Right 1067135661 10:43605514-43605536 CCTGAACTGACAGAGACTAGTGG 0: 1
1: 0
2: 0
3: 13
4: 158
1067135654_1067135661 29 Left 1067135654 10:43605462-43605484 CCCCTGATTAATCTGCGCAAACA No data
Right 1067135661 10:43605514-43605536 CCTGAACTGACAGAGACTAGTGG 0: 1
1: 0
2: 0
3: 13
4: 158
1067135656_1067135661 27 Left 1067135656 10:43605464-43605486 CCTGATTAATCTGCGCAAACAGT 0: 1
1: 2
2: 0
3: 3
4: 50
Right 1067135661 10:43605514-43605536 CCTGAACTGACAGAGACTAGTGG 0: 1
1: 0
2: 0
3: 13
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067135661 Original CRISPR CCTGAACTGACAGAGACTAG TGG Intergenic
900182408 1:1317469-1317491 CATGAACTGAAAGACACCAGAGG + Intronic
900834494 1:4989845-4989867 CTTCAACTGACATAGCCTAGAGG - Intergenic
900928382 1:5720171-5720193 CGTGAACTGACAGAGATGTGGGG - Intergenic
900982961 1:6057023-6057045 CCTAAACTCACAGAGGCTGGGGG - Intronic
902481747 1:16715687-16715709 GGTGAACTGACAGACACCAGGGG + Intergenic
903826448 1:26149098-26149120 GCTGAACTGCCAGAGTCAAGGGG - Intergenic
904088101 1:27925099-27925121 CGGGAACTGCCTGAGACTAGAGG + Intergenic
904654240 1:32031507-32031529 ATTGAACTGACAGAAAATAGAGG - Exonic
906660099 1:47575823-47575845 CCTGCACTGATGGAGACTAAAGG + Intergenic
909838308 1:80285831-80285853 CCTGGACTGACTAAAACTAGGGG - Intergenic
910557280 1:88549350-88549372 CCTAAACTAAGAGAGACAAGGGG - Intergenic
911461360 1:98195217-98195239 CTTCCACTTACAGAGACTAGAGG - Intergenic
912761796 1:112374060-112374082 CCTGAACTGAGGGAGACTTTTGG - Intergenic
912863539 1:113236619-113236641 CCTGAAGTGAGAGAGGCCAGAGG - Intergenic
913483330 1:119310696-119310718 CCAGAAGTGACAGAGAATAATGG + Intergenic
918044128 1:180931077-180931099 CCTGAACAGACAGGGACTCCAGG + Intronic
918926247 1:190790864-190790886 CCTGTTCTGACAGAGAATATTGG + Intergenic
920760623 1:208780660-208780682 CCTAGACTGACAGAGACAAAAGG - Intergenic
921712255 1:218384859-218384881 CCTCAACTGTCAGAGACAATCGG - Intronic
921811021 1:219514600-219514622 CCTGCACTCACGGAGACTATTGG - Intergenic
921940955 1:220839244-220839266 CCTGAACTGCCAATGACTAAAGG - Intergenic
923404420 1:233645977-233645999 CCTGAAATGAGGAAGACTAGGGG + Intronic
923575470 1:235154697-235154719 CCTGAATTGGCAGGGACTACAGG + Intronic
924242921 1:242057399-242057421 CCAGAACTGCGAGAGACAAGAGG - Intergenic
1065953163 10:30670133-30670155 CCTGATGTGACAGATACGAGAGG + Intergenic
1067135661 10:43605514-43605536 CCTGAACTGACAGAGACTAGTGG + Intergenic
1069478146 10:68755241-68755263 CCTTGACTGACAGATACCAGAGG + Intronic
1069629460 10:69888981-69889003 CCTCAACTGAGAGAGGCGAGTGG - Intronic
1070417886 10:76207360-76207382 CCTGAACTAGCTGAGACTTGTGG - Intronic
1073491900 10:103857917-103857939 CCAAAAATGACAGAGACTGGGGG + Intergenic
1079539535 11:21555750-21555772 CCTGAAAAGACAAAGACTAAAGG - Intronic
1079881297 11:25930315-25930337 CCTGAAGTGACAGAGGGGAGAGG + Intergenic
1080404148 11:31964171-31964193 CATGAAGTGACAGAGCCTGGGGG - Intronic
1080898259 11:36463505-36463527 TCTGAAATGAGAGAGACAAGAGG - Exonic
1083864909 11:65448483-65448505 CCTGAAGTCAAAGAGACTTGTGG + Intergenic
1085449366 11:76622773-76622795 CCTTCACTGACAGATACCAGAGG - Intergenic
1091346543 11:134857924-134857946 CCTAAACAGACAGAAACTGGGGG + Intergenic
1092254493 12:6918856-6918878 CCTGTAATCACAGATACTAGCGG + Intronic
1092804454 12:12206884-12206906 GCTGAACTCACAGAGCCTATTGG - Intronic
1092977149 12:13756353-13756375 CCTGAAAGGACTGAGACAAGTGG + Intronic
1093211469 12:16314083-16314105 CCTGAACAGACAGAGACATCAGG - Intergenic
1095291440 12:40484080-40484102 CCTGGAGTGACAGGGACAAGTGG + Exonic
1095643258 12:44509761-44509783 CCTGAACTGACTAAGACAAAAGG + Intronic
1104025065 12:125019884-125019906 CCTGAACTGACCAAGACAATAGG - Intronic
1108599637 13:51981344-51981366 CCTGAGGTGACAGATACTAGTGG - Intronic
1111180148 13:84653381-84653403 TCTACACAGACAGAGACTAGGGG + Intergenic
1113784048 13:112993167-112993189 GCTGTACTGACAGAGGCTGGGGG + Intronic
1115599719 14:34943702-34943724 CCAGAAGTGACAAAGACTATAGG + Intergenic
1118606194 14:67505625-67505647 CCTTAGCTGAAAGAGGCTAGAGG + Intronic
1118798647 14:69168630-69168652 ACTGCACTGACAGCCACTAGAGG - Intergenic
1119559495 14:75578844-75578866 CCAGAAGAAACAGAGACTAGAGG - Exonic
1119875696 14:78057352-78057374 CATGAACTGGCAGTAACTAGTGG + Intergenic
1119944076 14:78673528-78673550 CCTGAACTGACGGAGACATCTGG - Intronic
1120169215 14:81232248-81232270 TCTGAACTGACAGTGACTCCAGG + Intergenic
1120537935 14:85720316-85720338 CCTGAGGTGTCAGAGAATAGAGG - Intergenic
1122352151 14:101102605-101102627 CCTGAACTGACCCAGTCTGGGGG - Intergenic
1125189711 15:36976569-36976591 CCACAACTGACAGAGACTGAAGG + Intronic
1131446815 15:92505188-92505210 CCGGTACTGACAGAGATTGGGGG - Intergenic
1131533432 15:93214031-93214053 CCTGAACTGCCAAAGAGGAGGGG - Intergenic
1132256434 15:100380667-100380689 TCTCAACTCAAAGAGACTAGAGG + Intergenic
1132562264 16:601553-601575 AGTGAACTGACTGAGACTAGGGG - Intronic
1133024473 16:2981965-2981987 CATGACCTGTCAGAGACTTGGGG - Intergenic
1133527171 16:6616859-6616881 CATAAACAGACAGAGGCTAGAGG - Intronic
1134247779 16:12552827-12552849 CCTGACCTGCCAGAGAGGAGAGG + Intronic
1134258387 16:12630421-12630443 CCTGAACTGCCAGTCATTAGGGG - Intergenic
1137030219 16:35517016-35517038 CCTGAACTGACAGCCACAAGTGG + Intergenic
1137540945 16:49361225-49361247 CCTGAGCTGACTGAGGCTAAGGG - Intergenic
1139932067 16:70536129-70536151 CCTGAACTAAGGGAGACTAAAGG - Intronic
1139970153 16:70769285-70769307 CCTGAACTGAGTGAAACTGGTGG + Intronic
1140042059 16:71414571-71414593 CCTGTACTCACAGATACTTGGGG + Intergenic
1140864275 16:79046366-79046388 CCTGAACTGATAAAGACAACAGG - Intronic
1141546439 16:84773134-84773156 CGTGACCTGACAGAGACTTGAGG - Intronic
1149565537 17:57638295-57638317 ACTGAAGTGACAGAGAGCAGAGG - Intronic
1149572065 17:57678924-57678946 CCTGAATTGACTGGGAGTAGGGG - Intronic
1150502511 17:65664783-65664805 CCTGAGCTGACTAAGACAAGTGG - Intronic
1151487464 17:74410219-74410241 CCTCAACTGACAGAGCACAGCGG + Intergenic
1152020534 17:77777989-77778011 CCCTAACTGGCAGAGACCAGAGG + Intergenic
1153192352 18:2555979-2556001 CCTTAACTCAGAGAGACTATTGG - Intronic
1153703849 18:7725039-7725061 CCTGAATTGGCAGAGACAAAGGG + Intronic
1153750278 18:8222500-8222522 CCGGAACTGACAGAGTATGGGGG + Intronic
1153834509 18:8951891-8951913 CCTGAAATGCAAGAGACTAAGGG - Intergenic
1158236270 18:55318973-55318995 CCTGAACTGAGAGAGGCCAGAGG - Intronic
1158845833 18:61441985-61442007 CCTGAACTGAGAGAGACAGGAGG - Intronic
1159137753 18:64356967-64356989 TCTGAACTGACTAAGACTCGGGG - Intergenic
1160257723 18:77261476-77261498 CCTGAACAGACTAAGACCAGTGG - Intronic
1168538304 19:57190445-57190467 CCTCAACTGACTAAAACTAGGGG - Intergenic
1202715786 1_KI270714v1_random:41599-41621 GGTGAACTGACAGACACCAGGGG + Intergenic
927312385 2:21645855-21645877 TCTGAACTCACAAAGACTGGAGG + Intergenic
928250678 2:29675499-29675521 CCTGATGGGACAGAGACCAGGGG + Intronic
931148978 2:59551499-59551521 CCTGAACTATCTGAGAATAGGGG - Intergenic
933293139 2:80459894-80459916 GCTGGACTGGCAGAGACTTGGGG + Intronic
933449269 2:82425590-82425612 CTTGAAATGACAGAGATGAGTGG - Intergenic
937527343 2:122787573-122787595 CTTGAACTGACTGAGACAATGGG + Intergenic
945778305 2:214134724-214134746 TCTTAACTTACTGAGACTAGTGG + Intronic
948788810 2:240366522-240366544 CCTGCACTGGCAGAGCCCAGGGG - Intergenic
1170932157 20:20778936-20778958 TCTGAACTGAAGGAGACTGGAGG + Intergenic
1173057676 20:39631873-39631895 ACTGAAGGGACAGAGATTAGAGG - Intergenic
1175074495 20:56361191-56361213 CCAGAACTGACGGAGACAAAAGG - Intronic
1175636410 20:60587944-60587966 CCTGAATTCACAGAGGCCAGAGG - Intergenic
1177403567 21:20637606-20637628 CCTGAACTGACTAAGACAGGGGG - Intergenic
1182896598 22:33864116-33864138 CTTGACCTGACAGAGACAGGAGG + Intronic
1183580860 22:38725927-38725949 CCTGCCCTGACACAGACCAGGGG - Intronic
950399805 3:12761174-12761196 CCTGAACAGCCAGAGAGTGGGGG + Intronic
950758579 3:15199741-15199763 CCAAAACTGACTGAGACAAGTGG + Intergenic
950870064 3:16220616-16220638 CCTGAAAAGAGAGAGACTTGGGG - Intronic
951108186 3:18770101-18770123 CCTGAACTGACTGAGACAGTGGG - Intergenic
954458969 3:50615651-50615673 CCTGACCTTACAGAGCCTAGAGG - Intronic
957146764 3:76434718-76434740 CCTCAACTGGTAGAGACTGGGGG - Intronic
958616683 3:96502433-96502455 TCTGAAATGACTGGGACTAGAGG - Intergenic
958638646 3:96777385-96777407 CCAGAACTGGCAATGACTAGTGG + Intergenic
963662217 3:148141448-148141470 CCTGATCTTACAGAGATTACAGG + Intergenic
964604758 3:158548753-158548775 CCTGAGCTGACAGAGGCTTTCGG + Intergenic
965136756 3:164783527-164783549 CTTGAACTGACATAGATTAAAGG - Intergenic
966351193 3:179034037-179034059 CTTGAACTGACACAAACTAGTGG + Intronic
968233273 3:197016541-197016563 CCAGAACTGACAGGGCCCAGGGG - Intronic
970479546 4:16459144-16459166 CCTGAACTCACAGAGTACAGGGG - Intergenic
970641276 4:18069129-18069151 GCTGAACTTACAGAGACTTTGGG - Intergenic
971697675 4:29927790-29927812 CTTGAACTGGCATATACTAGAGG - Intergenic
972405318 4:38740643-38740665 CCTAAAGTGACAGAGAGTTGGGG + Intergenic
981211309 4:142109238-142109260 CTGGAAGTGAAAGAGACTAGGGG - Intronic
983346700 4:166535910-166535932 CATCAACTGACAGAGAGTAAGGG - Intergenic
991260101 5:64657871-64657893 CCTGGACTGACATAGACTTTGGG - Intergenic
996569987 5:124922871-124922893 CCTGAAGTGACAGAAACAGGAGG - Intergenic
997294637 5:132761925-132761947 CCTGAGCTGACACAGACTAATGG + Intronic
997594008 5:135094438-135094460 CCTGAACTGACTGAGTAAAGAGG - Intronic
999945926 5:156595455-156595477 CCTGAACTGACTAAGACAAATGG + Intronic
1000937469 5:167320387-167320409 CCTGAATTGACAGATTCTACAGG + Intronic
1003879186 6:10464953-10464975 CCTGAAGTGACGGAGAAGAGAGG - Intergenic
1004449532 6:15732331-15732353 CCTGAACAGACAGAAAAGAGAGG + Intergenic
1005044237 6:21626890-21626912 CATAAACTGAGGGAGACTAGGGG - Intergenic
1006021087 6:31118013-31118035 CCTGAAGAGACAGAGAATTGGGG + Intronic
1008033408 6:46721428-46721450 GCTGGACTGACAGAAACTTGAGG - Intronic
1009743255 6:67776414-67776436 CATGAACTGAAGGACACTAGGGG - Intergenic
1012272759 6:97235288-97235310 CCTGAAATGGCAAAGACTAAAGG + Intronic
1012806118 6:103895222-103895244 CCAGCACTGCCAGAGAGTAGTGG + Intergenic
1013084528 6:106845165-106845187 CATGAACAGCCAGAGACTAGAGG + Intergenic
1019008708 6:168824939-168824961 GCTGAACCGGCTGAGACTAGGGG + Intergenic
1019728077 7:2613878-2613900 AGTGACCTGACTGAGACTAGCGG + Exonic
1024363802 7:48498141-48498163 CCCCACCTGACAGAGACAAGGGG - Intronic
1030018338 7:105246840-105246862 CCTGAACTGTCAGAGAGAAATGG + Intronic
1030236020 7:107263018-107263040 CCAGTACTGAGATAGACTAGAGG - Intronic
1030719559 7:112854110-112854132 CCTTAAATGACTGAGACAAGAGG - Intronic
1034819377 7:154202690-154202712 CCTGAACTAACAGGGCCCAGTGG - Intronic
1036785586 8:11683841-11683863 CCTGAGCTGGCAGAGAGTACAGG - Intronic
1038652508 8:29418450-29418472 CCTGAAGGGAAAGAGGCTAGTGG + Intergenic
1039397032 8:37235204-37235226 CCAGGACTGACAGTGACAAGAGG + Intergenic
1039644802 8:39269193-39269215 CCTCAACTCAGAGAGACTACTGG + Intronic
1041684029 8:60626017-60626039 GAGGAACTGTCAGAGACTAGAGG + Intergenic
1042922822 8:73936572-73936594 CATGAAGTGACATGGACTAGTGG - Intergenic
1043715641 8:83482139-83482161 CCTGAACTGACTGAGACACATGG + Intergenic
1045100139 8:98835847-98835869 CCTGAACTGACTAAGACAACAGG - Intronic
1046775278 8:118158007-118158029 CCTCAACTTACAGAGACCACTGG - Intergenic
1048768692 8:137871243-137871265 CCTACATTGACAGAGACTGGAGG + Intergenic
1049723614 8:144134318-144134340 CCTGAGCTGACTGAGACAATGGG - Intergenic
1049732244 8:144184688-144184710 CCTGAGCTGGCAGAGAGAAGGGG + Intronic
1053048819 9:34941537-34941559 CCTGAACAGACTGAGACAAAGGG - Intergenic
1053269918 9:36742920-36742942 ACTGAATTGACTGAGACTAGGGG + Intergenic
1056222981 9:84468211-84468233 CCTGAACTTACTGAGACGGGGGG + Intergenic
1056285356 9:85082191-85082213 CCTGAACTGACTAAGACAAGAGG + Intergenic
1056407174 9:86285623-86285645 ACTGAACTGCCTGAGATTAGGGG + Intergenic
1056801617 9:89696134-89696156 CCAAAAGTGACAGAGACTATAGG - Intergenic
1059057482 9:110999486-110999508 CCTGAACTGACTAAGACAAGTGG - Intronic
1059792214 9:117652455-117652477 TCTGAACTGATAGAGACAACAGG - Intergenic
1060075221 9:120584847-120584869 ACAGAACTGTCAGAGACTGGAGG - Intergenic
1061365639 9:130171555-130171577 CCTGAATGGACAGAGGCCAGTGG - Intergenic
1187884019 X:23872019-23872041 CCTCAAATGACCCAGACTAGAGG - Intronic
1190579755 X:51880954-51880976 CCCGAACTGACTAAGACAAGAGG - Intronic
1192766466 X:74145536-74145558 ACTAAACTTACAGTGACTAGAGG - Intergenic
1193702472 X:84779940-84779962 CCTGAGCTGCCAGAGTCCAGGGG - Intergenic
1196987940 X:121295359-121295381 CCTAAGCAGAAAGAGACTAGAGG - Intergenic
1198593925 X:138215670-138215692 CTTGAAGTGACAGAGAATTGAGG - Intergenic
1200397346 X:155999015-155999037 CCTGAACTGACAGGGCCCAAGGG - Intronic