ID: 1067135914

View in Genome Browser
Species Human (GRCh38)
Location 10:43606896-43606918
Sequence CGCCCGCCCGTTCCCTCCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 120}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067135914_1067135925 21 Left 1067135914 10:43606896-43606918 CCTGTGGAGGGAACGGGCGGGCG 0: 1
1: 0
2: 0
3: 9
4: 120
Right 1067135925 10:43606940-43606962 ATTCTAGCTAGGCTAGGGCACGG 0: 1
1: 0
2: 0
3: 5
4: 94
1067135914_1067135924 16 Left 1067135914 10:43606896-43606918 CCTGTGGAGGGAACGGGCGGGCG 0: 1
1: 0
2: 0
3: 9
4: 120
Right 1067135924 10:43606935-43606957 GGCAGATTCTAGCTAGGCTAGGG 0: 1
1: 0
2: 0
3: 8
4: 69
1067135914_1067135922 10 Left 1067135914 10:43606896-43606918 CCTGTGGAGGGAACGGGCGGGCG 0: 1
1: 0
2: 0
3: 9
4: 120
Right 1067135922 10:43606929-43606951 CTAGAGGGCAGATTCTAGCTAGG 0: 1
1: 0
2: 0
3: 20
4: 163
1067135914_1067135920 -5 Left 1067135914 10:43606896-43606918 CCTGTGGAGGGAACGGGCGGGCG 0: 1
1: 0
2: 0
3: 9
4: 120
Right 1067135920 10:43606914-43606936 GGGCGGGGACCTGGTCTAGAGGG 0: 1
1: 0
2: 0
3: 8
4: 117
1067135914_1067135919 -6 Left 1067135914 10:43606896-43606918 CCTGTGGAGGGAACGGGCGGGCG 0: 1
1: 0
2: 0
3: 9
4: 120
Right 1067135919 10:43606913-43606935 CGGGCGGGGACCTGGTCTAGAGG 0: 1
1: 0
2: 0
3: 7
4: 82
1067135914_1067135927 25 Left 1067135914 10:43606896-43606918 CCTGTGGAGGGAACGGGCGGGCG 0: 1
1: 0
2: 0
3: 9
4: 120
Right 1067135927 10:43606944-43606966 TAGCTAGGCTAGGGCACGGAGGG 0: 1
1: 0
2: 2
3: 6
4: 63
1067135914_1067135926 24 Left 1067135914 10:43606896-43606918 CCTGTGGAGGGAACGGGCGGGCG 0: 1
1: 0
2: 0
3: 9
4: 120
Right 1067135926 10:43606943-43606965 CTAGCTAGGCTAGGGCACGGAGG 0: 1
1: 0
2: 0
3: 12
4: 75
1067135914_1067135923 15 Left 1067135914 10:43606896-43606918 CCTGTGGAGGGAACGGGCGGGCG 0: 1
1: 0
2: 0
3: 9
4: 120
Right 1067135923 10:43606934-43606956 GGGCAGATTCTAGCTAGGCTAGG 0: 1
1: 0
2: 2
3: 7
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067135914 Original CRISPR CGCCCGCCCGTTCCCTCCAC AGG (reversed) Intronic