ID: 1067137795

View in Genome Browser
Species Human (GRCh38)
Location 10:43626597-43626619
Sequence AAAAAGTAATACACAAGTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067137795_1067137801 9 Left 1067137795 10:43626597-43626619 CCCAGACTTGTGTATTACTTTTT No data
Right 1067137801 10:43626629-43626651 GTCCAATCATTTGGCTTCCCTGG 0: 11
1: 701
2: 1015
3: 715
4: 423
1067137795_1067137802 10 Left 1067137795 10:43626597-43626619 CCCAGACTTGTGTATTACTTTTT No data
Right 1067137802 10:43626630-43626652 TCCAATCATTTGGCTTCCCTGGG 0: 8
1: 753
2: 1020
3: 645
4: 466
1067137795_1067137800 0 Left 1067137795 10:43626597-43626619 CCCAGACTTGTGTATTACTTTTT No data
Right 1067137800 10:43626620-43626642 AGCAGGGGTGTCCAATCATTTGG No data
1067137795_1067137804 19 Left 1067137795 10:43626597-43626619 CCCAGACTTGTGTATTACTTTTT No data
Right 1067137804 10:43626639-43626661 TTGGCTTCCCTGGGCCACATTGG 0: 419
1: 887
2: 867
3: 500
4: 324

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067137795 Original CRISPR AAAAAGTAATACACAAGTCT GGG (reversed) Intergenic
No off target data available for this crispr