ID: 1067139140

View in Genome Browser
Species Human (GRCh38)
Location 10:43641443-43641465
Sequence CAGTCATGTGAAGGTTCTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067139138_1067139140 -3 Left 1067139138 10:43641423-43641445 CCAGATGTCAGATGGGGCTGCAG No data
Right 1067139140 10:43641443-43641465 CAGTCATGTGAAGGTTCTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067139140 Original CRISPR CAGTCATGTGAAGGTTCTAC TGG Intergenic
No off target data available for this crispr