ID: 1067139346

View in Genome Browser
Species Human (GRCh38)
Location 10:43643513-43643535
Sequence ATCACTCATGTCTATAGCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067139346_1067139351 -1 Left 1067139346 10:43643513-43643535 CCCTTGCTATAGACATGAGTGAT No data
Right 1067139351 10:43643535-43643557 TTAGTTACAATAGGTTATTGGGG No data
1067139346_1067139348 -10 Left 1067139346 10:43643513-43643535 CCCTTGCTATAGACATGAGTGAT No data
Right 1067139348 10:43643526-43643548 CATGAGTGATTAGTTACAATAGG No data
1067139346_1067139349 -3 Left 1067139346 10:43643513-43643535 CCCTTGCTATAGACATGAGTGAT No data
Right 1067139349 10:43643533-43643555 GATTAGTTACAATAGGTTATTGG No data
1067139346_1067139353 11 Left 1067139346 10:43643513-43643535 CCCTTGCTATAGACATGAGTGAT No data
Right 1067139353 10:43643547-43643569 GGTTATTGGGGGTATCATCCAGG No data
1067139346_1067139352 0 Left 1067139346 10:43643513-43643535 CCCTTGCTATAGACATGAGTGAT No data
Right 1067139352 10:43643536-43643558 TAGTTACAATAGGTTATTGGGGG No data
1067139346_1067139350 -2 Left 1067139346 10:43643513-43643535 CCCTTGCTATAGACATGAGTGAT No data
Right 1067139350 10:43643534-43643556 ATTAGTTACAATAGGTTATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067139346 Original CRISPR ATCACTCATGTCTATAGCAA GGG (reversed) Intergenic
No off target data available for this crispr