ID: 1067139896

View in Genome Browser
Species Human (GRCh38)
Location 10:43648438-43648460
Sequence GCTGAAGCCCGCACGGAGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 124}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067139881_1067139896 21 Left 1067139881 10:43648394-43648416 CCTCTCCTCCCACCCCGGAAGGC 0: 1
1: 0
2: 3
3: 37
4: 450
Right 1067139896 10:43648438-43648460 GCTGAAGCCCGCACGGAGGCCGG 0: 1
1: 0
2: 0
3: 8
4: 124
1067139890_1067139896 -1 Left 1067139890 10:43648416-43648438 CCGGCACCGGCTTCCCGCACTCG 0: 1
1: 0
2: 1
3: 5
4: 99
Right 1067139896 10:43648438-43648460 GCTGAAGCCCGCACGGAGGCCGG 0: 1
1: 0
2: 0
3: 8
4: 124
1067139884_1067139896 13 Left 1067139884 10:43648402-43648424 CCCACCCCGGAAGGCCGGCACCG 0: 1
1: 0
2: 0
3: 5
4: 65
Right 1067139896 10:43648438-43648460 GCTGAAGCCCGCACGGAGGCCGG 0: 1
1: 0
2: 0
3: 8
4: 124
1067139885_1067139896 12 Left 1067139885 10:43648403-43648425 CCACCCCGGAAGGCCGGCACCGG 0: 1
1: 0
2: 0
3: 4
4: 92
Right 1067139896 10:43648438-43648460 GCTGAAGCCCGCACGGAGGCCGG 0: 1
1: 0
2: 0
3: 8
4: 124
1067139883_1067139896 16 Left 1067139883 10:43648399-43648421 CCTCCCACCCCGGAAGGCCGGCA 0: 1
1: 0
2: 0
3: 13
4: 140
Right 1067139896 10:43648438-43648460 GCTGAAGCCCGCACGGAGGCCGG 0: 1
1: 0
2: 0
3: 8
4: 124
1067139888_1067139896 8 Left 1067139888 10:43648407-43648429 CCCGGAAGGCCGGCACCGGCTTC 0: 1
1: 0
2: 3
3: 14
4: 102
Right 1067139896 10:43648438-43648460 GCTGAAGCCCGCACGGAGGCCGG 0: 1
1: 0
2: 0
3: 8
4: 124
1067139887_1067139896 9 Left 1067139887 10:43648406-43648428 CCCCGGAAGGCCGGCACCGGCTT 0: 1
1: 0
2: 0
3: 5
4: 51
Right 1067139896 10:43648438-43648460 GCTGAAGCCCGCACGGAGGCCGG 0: 1
1: 0
2: 0
3: 8
4: 124
1067139889_1067139896 7 Left 1067139889 10:43648408-43648430 CCGGAAGGCCGGCACCGGCTTCC 0: 1
1: 0
2: 1
3: 9
4: 101
Right 1067139896 10:43648438-43648460 GCTGAAGCCCGCACGGAGGCCGG 0: 1
1: 0
2: 0
3: 8
4: 124
1067139891_1067139896 -7 Left 1067139891 10:43648422-43648444 CCGGCTTCCCGCACTCGCTGAAG 0: 1
1: 0
2: 1
3: 5
4: 148
Right 1067139896 10:43648438-43648460 GCTGAAGCCCGCACGGAGGCCGG 0: 1
1: 0
2: 0
3: 8
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067139896 Original CRISPR GCTGAAGCCCGCACGGAGGC CGG Intronic
900922906 1:5685011-5685033 ACTGAAGCCAGGAGGGAGGCTGG + Intergenic
900981006 1:6046162-6046184 GCAGACGCCCCCACGAAGGCAGG + Exonic
901199077 1:7456641-7456663 GCTGGGGCCCGCAGGGAGCCAGG + Intronic
901433244 1:9231007-9231029 GCTGAAGCCAGCAAGGAAACGGG + Intergenic
901853370 1:12029690-12029712 GCTGAGGGCAGCACGGAGCCTGG + Intronic
905391629 1:37639460-37639482 GCTGAAGCCCCAGTGGAGGCTGG - Intergenic
917222625 1:172748276-172748298 GCTGAAGCCCGCGGCGGGGCAGG + Intergenic
919831523 1:201544056-201544078 AATGAAGCCCGCGCTGAGGCTGG - Intergenic
920371219 1:205480659-205480681 GCTGGAGGCCGCATGGAGGATGG + Intergenic
921923413 1:220691923-220691945 CCTGAAGCCCCCCCGGGGGCGGG - Intronic
922842166 1:228651293-228651315 ACTGGAGCCAGCACTGAGGCAGG - Intergenic
922905502 1:229170659-229170681 TCTGAGGGCCTCACGGAGGCTGG + Intergenic
923055580 1:230424486-230424508 GCTGCAGCCTGCTGGGAGGCCGG - Intronic
923779209 1:237007285-237007307 GCTGATGCCGCCACGGAGCCTGG - Intergenic
1064410120 10:15097486-15097508 GCCGAAGCCCGCGCGCACGCAGG + Exonic
1067139896 10:43648438-43648460 GCTGAAGCCCGCACGGAGGCCGG + Intronic
1069721381 10:70551625-70551647 GCTGAAGCCGGCAGGGGGCCAGG - Intronic
1069723969 10:70565887-70565909 GCTGAATCCCCCACTGGGGCTGG + Intronic
1070798392 10:79230472-79230494 GCTCAAGACCACACGGAGCCTGG - Intronic
1072518496 10:96209954-96209976 GCTGATGCTCACACTGAGGCTGG + Intronic
1078110471 11:8388035-8388057 GCAGAAGCCTGGACGGAGACAGG + Intergenic
1079251683 11:18791848-18791870 GCGGAAGCCCGCCCGGGGGCGGG - Intronic
1080400524 11:31931175-31931197 GATGAAGCTGGCAGGGAGGCTGG - Intronic
1084267933 11:68014533-68014555 GCTGGCACCAGCACGGAGGCAGG + Intronic
1085710342 11:78823596-78823618 GCTGAAGCCTGGAAAGAGGCGGG + Intronic
1089651967 11:119920426-119920448 GCTGAAGCACAAAGGGAGGCAGG - Intergenic
1090260430 11:125315099-125315121 GCTGAAGCCTGCTCAGAGGGAGG + Intronic
1091709979 12:2732796-2732818 GCTGAAGGCAGCATGGAGGCTGG - Intergenic
1091798686 12:3311213-3311235 TCTGGATCCCGCACTGAGGCTGG + Intergenic
1092758685 12:11789454-11789476 GCTGAAGCCCAGACCGAAGCAGG - Intronic
1098704131 12:73665469-73665491 GCAAATGCCCGCACGGAGGCCGG + Intergenic
1100963081 12:99984789-99984811 GCTGTGGCCCGCGCCGAGGCAGG + Intergenic
1117913293 14:60654045-60654067 GGTGTAGCCTGCACGGAGGGCGG + Intronic
1121464016 14:94102564-94102586 GCTGAACACCACACTGAGGCAGG + Exonic
1122475730 14:102007721-102007743 CGTGAAGCCAGCACTGAGGCAGG + Intronic
1122613533 14:103001543-103001565 GCTGCAGCCCCCACTGTGGCCGG - Intronic
1123706901 15:22957124-22957146 ACTGCAGCCCGCACTGAGACAGG + Intronic
1124606743 15:31175003-31175025 GCTAAAGGCCCCACGGAGTCAGG + Intergenic
1128833622 15:70791419-70791441 GCTGGAGCCAGAACTGAGGCTGG - Intergenic
1132146249 15:99431717-99431739 CCTGAACCCCGCAGGGAGGCCGG - Intergenic
1132382110 15:101373203-101373225 GCTGCTGCCTGCAGGGAGGCTGG + Intronic
1132678269 16:1129616-1129638 GCGGCAGCCCGCACGGAGCGGGG - Intergenic
1132708952 16:1258140-1258162 GCTGTGGCCCGTATGGAGGCCGG - Exonic
1133607782 16:7405261-7405283 GCTGATGCCAGCCCAGAGGCAGG + Intronic
1133813178 16:9177126-9177148 GCTGAAGACCTCAGGGAGGCAGG - Intergenic
1137512376 16:49113001-49113023 GCTGCAGCCAGCAAGGAAGCAGG - Intergenic
1142129150 16:88424882-88424904 GCAGCAGCCTGCACCGAGGCTGG + Intergenic
1142900234 17:3007149-3007171 GCTGAAGGACCCACGGGGGCTGG + Intronic
1143269500 17:5665403-5665425 CGTGAAGCCTGCACTGAGGCTGG - Intergenic
1144675452 17:17158702-17158724 GCGGGAGCGTGCACGGAGGCGGG + Exonic
1148048505 17:44758389-44758411 CCTGAAGCCCTCCTGGAGGCCGG + Intergenic
1148754934 17:49968576-49968598 GCGGAAGCCAGCACGCAGGGCGG + Intergenic
1148945786 17:51260644-51260666 GCGGAAGCCCGGAATGAGGCCGG + Exonic
1150802041 17:68290636-68290658 GCTGGCGCGCGCACGCAGGCCGG - Intronic
1152277309 17:79365577-79365599 ACTGAAGCCGGCGCGGCGGCAGG + Intronic
1152581286 17:81166480-81166502 GCTGAGGGGGGCACGGAGGCTGG + Intergenic
1156065309 18:33136094-33136116 GCTCAAGGTCCCACGGAGGCTGG - Intronic
1156461849 18:37325705-37325727 GCTGAAGGCAGCTGGGAGGCTGG - Intronic
1160864487 19:1250839-1250861 GCGGAAGCCGGCGCGGACGCAGG - Intronic
1161042549 19:2117681-2117703 GTTGGAGCCAGCACAGAGGCGGG - Intronic
1161317352 19:3623816-3623838 GGAGAAGCGCGCACGGCGGCTGG - Exonic
1161805440 19:6440707-6440729 GCTGCAACCTGCACGGATGCTGG - Exonic
1161911424 19:7197432-7197454 GCAGAGGCCCGGAAGGAGGCGGG + Intronic
1163856315 19:19704957-19704979 GCTGAATCCGGAACTGAGGCTGG + Intergenic
1165149348 19:33751806-33751828 GCTGAAGCCCCCACGGGAGCGGG + Intronic
1166706209 19:44909295-44909317 GCTGCAGGCTGCGCGGAGGCAGG - Exonic
1167379556 19:49130599-49130621 GGTGAGGCCCCCAGGGAGGCGGG + Exonic
925969437 2:9096398-9096420 GCTGCGGCCCGCAGAGAGGCAGG + Intergenic
927132840 2:20074990-20075012 GCTGAAGGCAGGATGGAGGCAGG - Intergenic
927714556 2:25343106-25343128 GCTGGGGCGCGCAAGGAGGCTGG - Intergenic
937216348 2:120315971-120315993 GCAGAAGCAAGCACAGAGGCAGG + Intergenic
942464076 2:176189388-176189410 GCTGAAGGCGGCAGGGAGGCCGG - Exonic
947764561 2:232629020-232629042 GCTGGAGCCGGCACGGATCCTGG + Intronic
947871342 2:233440570-233440592 TCTGAAGGCTGCAGGGAGGCGGG + Intronic
948519318 2:238525378-238525400 GCTGAAGCCTGGTCGGGGGCAGG + Intergenic
948873811 2:240817170-240817192 GCAGAAGCCGGCAAGGACGCAGG + Intronic
1168750754 20:279427-279449 GCAGGAGGCCGCACGGGGGCGGG - Intronic
1172121686 20:32602485-32602507 ACAGACGCCCGCCCGGAGGCAGG - Intronic
1172639444 20:36432055-36432077 GCTGAAGCCATCACGGTGGATGG - Exonic
1175771475 20:61627311-61627333 CCTGAAGCCGGCAGGCAGGCTGG - Intronic
1176242976 20:64083603-64083625 GCTGAAGCCCGCGCGGATCCCGG - Exonic
1176849511 21:13902000-13902022 GTTGAAGCCCCCACAGAGGGAGG - Intergenic
1180143489 21:45907041-45907063 GCTGAAGGCCAGGCGGAGGCCGG + Intronic
1180948261 22:19708594-19708616 GCAGGAGCCCTCACGCAGGCTGG + Intergenic
1183588801 22:38768220-38768242 GCTGAAGCCCGCAGGCCTGCAGG + Intronic
1184103486 22:42353974-42353996 GCTGAGGCCCTTAGGGAGGCTGG - Intergenic
1184523634 22:45009367-45009389 GCTGGAGCCTGCCCGGGGGCGGG - Intronic
1184695261 22:46135388-46135410 GCTGAAGCCAGCAAGGGGCCTGG + Intergenic
953474617 3:43194902-43194924 GCTGAAGGCACCAGGGAGGCTGG + Intergenic
953626899 3:44579267-44579289 GCGGGAGCGTGCACGGAGGCGGG - Intronic
954298515 3:49687007-49687029 GCGGTAGACCGCACGGAGTCAGG - Exonic
960090183 3:113630827-113630849 CCTGAATCCCACAGGGAGGCAGG + Intergenic
960497684 3:118394841-118394863 GCTGCAACCTGCACGGATGCTGG - Intergenic
961575413 3:127831990-127832012 GCAGCAGCCTGCACTGAGGCTGG + Intergenic
966911508 3:184562528-184562550 GCTGGAGCTGGCTCGGAGGCAGG + Intronic
968508892 4:986869-986891 CCTGAGGCCCGCAAGGAAGCGGG + Intronic
978339412 4:107706835-107706857 GCTGGAGTCCTCAGGGAGGCTGG + Intronic
982361502 4:154524020-154524042 GCTGGAGCCCAGATGGAGGCTGG + Intergenic
986256238 5:6103297-6103319 GCTGAGGCCTGAAGGGAGGCAGG - Intergenic
992104135 5:73436597-73436619 GCCGAAGCCCGCGCTGGGGCTGG + Intergenic
997446351 5:133943141-133943163 TCTGAACTCCTCACGGAGGCTGG + Intergenic
999658927 5:153838722-153838744 GCTGAAGCCCACAGTCAGGCAGG + Intergenic
1002600121 5:180349536-180349558 GCTGCAGCCAGCACAGAGACTGG + Intronic
1005922707 6:30415993-30416015 GCTGAAGCCCTCATGGACCCCGG - Intergenic
1007711718 6:43828333-43828355 GCTGCAGCTGGCAAGGAGGCAGG - Intergenic
1016936219 6:149451036-149451058 GCTGCAGGCCGGGCGGAGGCGGG + Exonic
1018831409 6:167446446-167446468 CCTGAAGCCCTGACGGGGGCAGG + Intergenic
1018866700 6:167751999-167752021 GATGGAGCCCGCATGAAGGCTGG - Intergenic
1019138799 6:169929945-169929967 GATGAAGCCCACAGGGAGGGTGG + Intergenic
1020083922 7:5300474-5300496 GATGAAGACCACACGCAGGCAGG - Exonic
1020308727 7:6854244-6854266 GCTGAAGCGGGCATGGAGCCTGG + Intergenic
1022521169 7:31007860-31007882 TCTGAAGCCTCCAGGGAGGCAGG - Intergenic
1023327471 7:39075645-39075667 CCTGAAGGCCACAGGGAGGCTGG + Intronic
1025210352 7:57016716-57016738 GATGAAGACCACACGCAGGCAGG + Intergenic
1025661603 7:63560131-63560153 GATGAAGACCACACGCAGGCAGG - Intergenic
1029203650 7:98855500-98855522 GCTGAAGCCTGCTCAGAGGGAGG + Intronic
1031043443 7:116862535-116862557 GCTGAGGACCGCACGGAAACGGG + Exonic
1033214345 7:139483056-139483078 GCTGCAGCCCGGACGGAGAGCGG - Exonic
1034982773 7:155489418-155489440 GCTGAAGTCCCCGTGGAGGCTGG - Intronic
1036916794 8:12811844-12811866 GCTGAAGCCAGCTGGGAGTCAGG - Intergenic
1043131822 8:76472253-76472275 GCCAAAGCCTGCACAGAGGCTGG - Intergenic
1045387914 8:101689159-101689181 GCTGAAGGCGTCACGGAGGAAGG + Exonic
1047723313 8:127662652-127662674 GCGGATGCAAGCACGGAGGCAGG - Intergenic
1053493174 9:38526883-38526905 GCAGAAGACCCCACGGGGGCGGG - Intergenic
1059460123 9:114424300-114424322 GCTGAAGCCAGTTGGGAGGCAGG + Intronic
1061056399 9:128225027-128225049 ACAGAAGCACGCAGGGAGGCAGG + Intronic
1062151902 9:135023981-135024003 GCTGCAGGCTGCACGGGGGCGGG + Intergenic
1062571975 9:137189932-137189954 GCTGAGGGGCACACGGAGGCAGG - Exonic
1185455598 X:309060-309082 ACTGAACCCCGCCCGGAGCCTGG - Intronic
1185633614 X:1535587-1535609 GCTGAAGCCCGTGGGGAAGCAGG - Intronic
1197677700 X:129347714-129347736 CCTGAAGCCTGCACGGAGCTGGG - Intergenic
1198268390 X:135032144-135032166 CCTAAAGCCCTCAAGGAGGCCGG - Intergenic
1200087017 X:153611919-153611941 ACAGAAGCCCGGACGGAAGCAGG - Intergenic