ID: 1067142057

View in Genome Browser
Species Human (GRCh38)
Location 10:43666481-43666503
Sequence CTCATGGGGGCCATAGTCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067142050_1067142057 -7 Left 1067142050 10:43666465-43666487 CCTGAGAGAAGGGGACCTCATGG No data
Right 1067142057 10:43666481-43666503 CTCATGGGGGCCATAGTCAAGGG No data
1067142049_1067142057 -4 Left 1067142049 10:43666462-43666484 CCTCCTGAGAGAAGGGGACCTCA No data
Right 1067142057 10:43666481-43666503 CTCATGGGGGCCATAGTCAAGGG No data
1067142044_1067142057 6 Left 1067142044 10:43666452-43666474 CCATTACTACCCTCCTGAGAGAA No data
Right 1067142057 10:43666481-43666503 CTCATGGGGGCCATAGTCAAGGG No data
1067142048_1067142057 -3 Left 1067142048 10:43666461-43666483 CCCTCCTGAGAGAAGGGGACCTC No data
Right 1067142057 10:43666481-43666503 CTCATGGGGGCCATAGTCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067142057 Original CRISPR CTCATGGGGGCCATAGTCAA GGG Intergenic
No off target data available for this crispr