ID: 1067142351

View in Genome Browser
Species Human (GRCh38)
Location 10:43667992-43668014
Sequence GAGGGGCCCCGCTTGCGCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067142346_1067142351 -10 Left 1067142346 10:43667979-43668001 CCCGGGGCGGCCGGAGGGGCCCC No data
Right 1067142351 10:43667992-43668014 GAGGGGCCCCGCTTGCGCAGGGG No data
1067142337_1067142351 15 Left 1067142337 10:43667954-43667976 CCGCGAGCGGGAGGAACACGCAC No data
Right 1067142351 10:43667992-43668014 GAGGGGCCCCGCTTGCGCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067142351 Original CRISPR GAGGGGCCCCGCTTGCGCAG GGG Intergenic
No off target data available for this crispr