ID: 1067145323

View in Genome Browser
Species Human (GRCh38)
Location 10:43689769-43689791
Sequence TGCACCGCGCACAAGGCGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067145323_1067145327 -6 Left 1067145323 10:43689769-43689791 CCTTCCGCCTTGTGCGCGGTGCA No data
Right 1067145327 10:43689786-43689808 GGTGCAGGCTGCCGAGAGCCCGG No data
1067145323_1067145334 17 Left 1067145323 10:43689769-43689791 CCTTCCGCCTTGTGCGCGGTGCA No data
Right 1067145334 10:43689809-43689831 CCGGGCAAGCCTTTCCGCCGTGG No data
1067145323_1067145329 -1 Left 1067145323 10:43689769-43689791 CCTTCCGCCTTGTGCGCGGTGCA No data
Right 1067145329 10:43689791-43689813 AGGCTGCCGAGAGCCCGGCCGGG No data
1067145323_1067145328 -2 Left 1067145323 10:43689769-43689791 CCTTCCGCCTTGTGCGCGGTGCA No data
Right 1067145328 10:43689790-43689812 CAGGCTGCCGAGAGCCCGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067145323 Original CRISPR TGCACCGCGCACAAGGCGGA AGG (reversed) Intergenic