ID: 1067145325

View in Genome Browser
Species Human (GRCh38)
Location 10:43689773-43689795
Sequence AGCCTGCACCGCGCACAAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067145325_1067145329 -5 Left 1067145325 10:43689773-43689795 CCGCCTTGTGCGCGGTGCAGGCT No data
Right 1067145329 10:43689791-43689813 AGGCTGCCGAGAGCCCGGCCGGG No data
1067145325_1067145328 -6 Left 1067145325 10:43689773-43689795 CCGCCTTGTGCGCGGTGCAGGCT No data
Right 1067145328 10:43689790-43689812 CAGGCTGCCGAGAGCCCGGCCGG No data
1067145325_1067145327 -10 Left 1067145325 10:43689773-43689795 CCGCCTTGTGCGCGGTGCAGGCT No data
Right 1067145327 10:43689786-43689808 GGTGCAGGCTGCCGAGAGCCCGG No data
1067145325_1067145334 13 Left 1067145325 10:43689773-43689795 CCGCCTTGTGCGCGGTGCAGGCT No data
Right 1067145334 10:43689809-43689831 CCGGGCAAGCCTTTCCGCCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067145325 Original CRISPR AGCCTGCACCGCGCACAAGG CGG (reversed) Intergenic
No off target data available for this crispr