ID: 1067145327

View in Genome Browser
Species Human (GRCh38)
Location 10:43689786-43689808
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067145320_1067145327 2 Left 1067145320 10:43689761-43689783 CCCTCACGCCTTCCGCCTTGTGC No data
Right 1067145327 10:43689786-43689808 GGTGCAGGCTGCCGAGAGCCCGG No data
1067145325_1067145327 -10 Left 1067145325 10:43689773-43689795 CCGCCTTGTGCGCGGTGCAGGCT No data
Right 1067145327 10:43689786-43689808 GGTGCAGGCTGCCGAGAGCCCGG No data
1067145321_1067145327 1 Left 1067145321 10:43689762-43689784 CCTCACGCCTTCCGCCTTGTGCG No data
Right 1067145327 10:43689786-43689808 GGTGCAGGCTGCCGAGAGCCCGG No data
1067145323_1067145327 -6 Left 1067145323 10:43689769-43689791 CCTTCCGCCTTGTGCGCGGTGCA No data
Right 1067145327 10:43689786-43689808 GGTGCAGGCTGCCGAGAGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067145327 Original CRISPR GGTGCAGGCTGCCGAGAGCC CGG Intergenic