ID: 1067147208

View in Genome Browser
Species Human (GRCh38)
Location 10:43702453-43702475
Sequence CAGCCTCCCCTGTACAGAGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 284
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 257}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067147198_1067147208 9 Left 1067147198 10:43702421-43702443 CCTGCCCATATCCCCGCCTTCCG 0: 1
1: 0
2: 0
3: 10
4: 145
Right 1067147208 10:43702453-43702475 CAGCCTCCCCTGTACAGAGGCGG 0: 1
1: 0
2: 2
3: 24
4: 257
1067147202_1067147208 -2 Left 1067147202 10:43702432-43702454 CCCCGCCTTCCGCAGAGGCTTCA 0: 1
1: 0
2: 1
3: 3
4: 115
Right 1067147208 10:43702453-43702475 CAGCCTCCCCTGTACAGAGGCGG 0: 1
1: 0
2: 2
3: 24
4: 257
1067147199_1067147208 5 Left 1067147199 10:43702425-43702447 CCCATATCCCCGCCTTCCGCAGA 0: 1
1: 0
2: 0
3: 3
4: 93
Right 1067147208 10:43702453-43702475 CAGCCTCCCCTGTACAGAGGCGG 0: 1
1: 0
2: 2
3: 24
4: 257
1067147203_1067147208 -3 Left 1067147203 10:43702433-43702455 CCCGCCTTCCGCAGAGGCTTCAG 0: 1
1: 0
2: 1
3: 18
4: 206
Right 1067147208 10:43702453-43702475 CAGCCTCCCCTGTACAGAGGCGG 0: 1
1: 0
2: 2
3: 24
4: 257
1067147195_1067147208 24 Left 1067147195 10:43702406-43702428 CCACCGGCGCTGCCACCTGCCCA 0: 1
1: 0
2: 2
3: 32
4: 385
Right 1067147208 10:43702453-43702475 CAGCCTCCCCTGTACAGAGGCGG 0: 1
1: 0
2: 2
3: 24
4: 257
1067147200_1067147208 4 Left 1067147200 10:43702426-43702448 CCATATCCCCGCCTTCCGCAGAG 0: 1
1: 0
2: 1
3: 3
4: 119
Right 1067147208 10:43702453-43702475 CAGCCTCCCCTGTACAGAGGCGG 0: 1
1: 0
2: 2
3: 24
4: 257
1067147205_1067147208 -7 Left 1067147205 10:43702437-43702459 CCTTCCGCAGAGGCTTCAGCCTC 0: 1
1: 0
2: 2
3: 22
4: 221
Right 1067147208 10:43702453-43702475 CAGCCTCCCCTGTACAGAGGCGG 0: 1
1: 0
2: 2
3: 24
4: 257
1067147196_1067147208 21 Left 1067147196 10:43702409-43702431 CCGGCGCTGCCACCTGCCCATAT 0: 1
1: 0
2: 1
3: 7
4: 174
Right 1067147208 10:43702453-43702475 CAGCCTCCCCTGTACAGAGGCGG 0: 1
1: 0
2: 2
3: 24
4: 257
1067147197_1067147208 12 Left 1067147197 10:43702418-43702440 CCACCTGCCCATATCCCCGCCTT 0: 1
1: 0
2: 0
3: 17
4: 320
Right 1067147208 10:43702453-43702475 CAGCCTCCCCTGTACAGAGGCGG 0: 1
1: 0
2: 2
3: 24
4: 257
1067147204_1067147208 -4 Left 1067147204 10:43702434-43702456 CCGCCTTCCGCAGAGGCTTCAGC 0: 1
1: 0
2: 0
3: 15
4: 187
Right 1067147208 10:43702453-43702475 CAGCCTCCCCTGTACAGAGGCGG 0: 1
1: 0
2: 2
3: 24
4: 257

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067147208 Original CRISPR CAGCCTCCCCTGTACAGAGG CGG Intergenic