ID: 1067150588

View in Genome Browser
Species Human (GRCh38)
Location 10:43729405-43729427
Sequence AGCTTTCAGTTAGATAAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067150588_1067150596 28 Left 1067150588 10:43729405-43729427 CCATTCTTATCTAACTGAAAGCT No data
Right 1067150596 10:43729456-43729478 CTCAGGTTCTATTCTAGTGGTGG No data
1067150588_1067150591 11 Left 1067150588 10:43729405-43729427 CCATTCTTATCTAACTGAAAGCT No data
Right 1067150591 10:43729439-43729461 GGCACCAAGTGCGCACCCTCAGG No data
1067150588_1067150589 -10 Left 1067150588 10:43729405-43729427 CCATTCTTATCTAACTGAAAGCT No data
Right 1067150589 10:43729418-43729440 ACTGAAAGCTTTCCAGCAGTTGG No data
1067150588_1067150593 25 Left 1067150588 10:43729405-43729427 CCATTCTTATCTAACTGAAAGCT No data
Right 1067150593 10:43729453-43729475 ACCCTCAGGTTCTATTCTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067150588 Original CRISPR AGCTTTCAGTTAGATAAGAA TGG (reversed) Intergenic
No off target data available for this crispr