ID: 1067150590

View in Genome Browser
Species Human (GRCh38)
Location 10:43729430-43729452
Sequence GCGCACTTGGTGCCAACTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067150590_1067150596 3 Left 1067150590 10:43729430-43729452 CCAGCAGTTGGCACCAAGTGCGC No data
Right 1067150596 10:43729456-43729478 CTCAGGTTCTATTCTAGTGGTGG No data
1067150590_1067150593 0 Left 1067150590 10:43729430-43729452 CCAGCAGTTGGCACCAAGTGCGC No data
Right 1067150593 10:43729453-43729475 ACCCTCAGGTTCTATTCTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067150590 Original CRISPR GCGCACTTGGTGCCAACTGC TGG (reversed) Intergenic
No off target data available for this crispr