ID: 1067150592

View in Genome Browser
Species Human (GRCh38)
Location 10:43729443-43729465
Sequence AGAACCTGAGGGTGCGCACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067150592_1067150596 -10 Left 1067150592 10:43729443-43729465 CCAAGTGCGCACCCTCAGGTTCT No data
Right 1067150596 10:43729456-43729478 CTCAGGTTCTATTCTAGTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067150592 Original CRISPR AGAACCTGAGGGTGCGCACT TGG (reversed) Intergenic
No off target data available for this crispr