ID: 1067150763

View in Genome Browser
Species Human (GRCh38)
Location 10:43731132-43731154
Sequence GACTCCCTTTAGCATTGTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067150763_1067150768 -3 Left 1067150763 10:43731132-43731154 CCCCCACAATGCTAAAGGGAGTC No data
Right 1067150768 10:43731152-43731174 GTCCTTCAGGATAAAATGAAAGG No data
1067150763_1067150770 5 Left 1067150763 10:43731132-43731154 CCCCCACAATGCTAAAGGGAGTC No data
Right 1067150770 10:43731160-43731182 GGATAAAATGAAAGGACACTAGG No data
1067150763_1067150771 12 Left 1067150763 10:43731132-43731154 CCCCCACAATGCTAAAGGGAGTC No data
Right 1067150771 10:43731167-43731189 ATGAAAGGACACTAGGTAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067150763 Original CRISPR GACTCCCTTTAGCATTGTGG GGG (reversed) Intergenic
No off target data available for this crispr