ID: 1067150792

View in Genome Browser
Species Human (GRCh38)
Location 10:43731666-43731688
Sequence AAGCAGAAACAGAAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067150792_1067150800 29 Left 1067150792 10:43731666-43731688 CCTTCCTCCTTCTGTTTCTGCTT No data
Right 1067150800 10:43731718-43731740 GGGTTCTCCCTCCTTCAGCCAGG No data
1067150792_1067150798 9 Left 1067150792 10:43731666-43731688 CCTTCCTCCTTCTGTTTCTGCTT No data
Right 1067150798 10:43731698-43731720 GCAAACTGATAAGAAAGCCTGGG No data
1067150792_1067150797 8 Left 1067150792 10:43731666-43731688 CCTTCCTCCTTCTGTTTCTGCTT No data
Right 1067150797 10:43731697-43731719 GGCAAACTGATAAGAAAGCCTGG No data
1067150792_1067150801 30 Left 1067150792 10:43731666-43731688 CCTTCCTCCTTCTGTTTCTGCTT No data
Right 1067150801 10:43731719-43731741 GGTTCTCCCTCCTTCAGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067150792 Original CRISPR AAGCAGAAACAGAAGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr