ID: 1067151943

View in Genome Browser
Species Human (GRCh38)
Location 10:43743145-43743167
Sequence CACACTTATGTCGAGAAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067151943_1067151947 -8 Left 1067151943 10:43743145-43743167 CCACCTTTCTCGACATAAGTGTG No data
Right 1067151947 10:43743160-43743182 TAAGTGTGACCGGGCACCCCAGG No data
1067151943_1067151949 4 Left 1067151943 10:43743145-43743167 CCACCTTTCTCGACATAAGTGTG No data
Right 1067151949 10:43743172-43743194 GGCACCCCAGGCCTCCCTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067151943 Original CRISPR CACACTTATGTCGAGAAAGG TGG (reversed) Intergenic
No off target data available for this crispr