ID: 1067156319

View in Genome Browser
Species Human (GRCh38)
Location 10:43783866-43783888
Sequence GTCCACTGTTGGCTTGGACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067156314_1067156319 21 Left 1067156314 10:43783822-43783844 CCTCCTAGGATGCACTTTGGCCA No data
Right 1067156319 10:43783866-43783888 GTCCACTGTTGGCTTGGACAAGG No data
1067156312_1067156319 24 Left 1067156312 10:43783819-43783841 CCTCCTCCTAGGATGCACTTTGG No data
Right 1067156319 10:43783866-43783888 GTCCACTGTTGGCTTGGACAAGG No data
1067156315_1067156319 18 Left 1067156315 10:43783825-43783847 CCTAGGATGCACTTTGGCCAAGT No data
Right 1067156319 10:43783866-43783888 GTCCACTGTTGGCTTGGACAAGG No data
1067156316_1067156319 1 Left 1067156316 10:43783842-43783864 CCAAGTGTGCTCATGCTCTTCTA No data
Right 1067156319 10:43783866-43783888 GTCCACTGTTGGCTTGGACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067156319 Original CRISPR GTCCACTGTTGGCTTGGACA AGG Intergenic
No off target data available for this crispr