ID: 1067161495

View in Genome Browser
Species Human (GRCh38)
Location 10:43828703-43828725
Sequence CCAGATCCCTCCCTTTAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067161495_1067161499 -5 Left 1067161495 10:43828703-43828725 CCTCTTTAAAGGGAGGGATCTGG No data
Right 1067161499 10:43828721-43828743 TCTGGAGCTGGGCTTTTTACAGG No data
1067161495_1067161502 15 Left 1067161495 10:43828703-43828725 CCTCTTTAAAGGGAGGGATCTGG No data
Right 1067161502 10:43828741-43828763 AGGTTCTGGAATCTAGAGCTGGG No data
1067161495_1067161501 14 Left 1067161495 10:43828703-43828725 CCTCTTTAAAGGGAGGGATCTGG No data
Right 1067161501 10:43828740-43828762 CAGGTTCTGGAATCTAGAGCTGG No data
1067161495_1067161503 25 Left 1067161495 10:43828703-43828725 CCTCTTTAAAGGGAGGGATCTGG No data
Right 1067161503 10:43828751-43828773 ATCTAGAGCTGGGATGTGTTTGG No data
1067161495_1067161500 1 Left 1067161495 10:43828703-43828725 CCTCTTTAAAGGGAGGGATCTGG No data
Right 1067161500 10:43828727-43828749 GCTGGGCTTTTTACAGGTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067161495 Original CRISPR CCAGATCCCTCCCTTTAAAG AGG (reversed) Intergenic
No off target data available for this crispr