ID: 1067164579

View in Genome Browser
Species Human (GRCh38)
Location 10:43855218-43855240
Sequence TCTTAACAAGAACCCTGTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067164579_1067164587 15 Left 1067164579 10:43855218-43855240 CCTCTACAGGGTTCTTGTTAAGA No data
Right 1067164587 10:43855256-43855278 GCTTGGCCACGTTGAGAAAAAGG No data
1067164579_1067164582 -2 Left 1067164579 10:43855218-43855240 CCTCTACAGGGTTCTTGTTAAGA No data
Right 1067164582 10:43855239-43855261 GAGGTGGCCCAACCCATGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067164579 Original CRISPR TCTTAACAAGAACCCTGTAG AGG (reversed) Intergenic
No off target data available for this crispr