ID: 1067164582

View in Genome Browser
Species Human (GRCh38)
Location 10:43855239-43855261
Sequence GAGGTGGCCCAACCCATGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067164579_1067164582 -2 Left 1067164579 10:43855218-43855240 CCTCTACAGGGTTCTTGTTAAGA No data
Right 1067164582 10:43855239-43855261 GAGGTGGCCCAACCCATGCTTGG No data
1067164575_1067164582 29 Left 1067164575 10:43855187-43855209 CCTGAGAGGCATGGTGGACGTGC No data
Right 1067164582 10:43855239-43855261 GAGGTGGCCCAACCCATGCTTGG No data
1067164578_1067164582 7 Left 1067164578 10:43855209-43855231 CCTGAGTTTCCTCTACAGGGTTC No data
Right 1067164582 10:43855239-43855261 GAGGTGGCCCAACCCATGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067164582 Original CRISPR GAGGTGGCCCAACCCATGCT TGG Intergenic
No off target data available for this crispr