ID: 1067164587

View in Genome Browser
Species Human (GRCh38)
Location 10:43855256-43855278
Sequence GCTTGGCCACGTTGAGAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067164578_1067164587 24 Left 1067164578 10:43855209-43855231 CCTGAGTTTCCTCTACAGGGTTC No data
Right 1067164587 10:43855256-43855278 GCTTGGCCACGTTGAGAAAAAGG No data
1067164579_1067164587 15 Left 1067164579 10:43855218-43855240 CCTCTACAGGGTTCTTGTTAAGA No data
Right 1067164587 10:43855256-43855278 GCTTGGCCACGTTGAGAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067164587 Original CRISPR GCTTGGCCACGTTGAGAAAA AGG Intergenic
No off target data available for this crispr