ID: 1067165735

View in Genome Browser
Species Human (GRCh38)
Location 10:43865129-43865151
Sequence TTGTTTTTCAATAAGGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067165735_1067165738 29 Left 1067165735 10:43865129-43865151 CCATCTTCCTTATTGAAAAACAA No data
Right 1067165738 10:43865181-43865203 TATGAAGACCTAATAATGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067165735 Original CRISPR TTGTTTTTCAATAAGGAAGA TGG (reversed) Intergenic
No off target data available for this crispr