ID: 1067168318

View in Genome Browser
Species Human (GRCh38)
Location 10:43883074-43883096
Sequence CCTCGAACTGTGTCAACCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067168313_1067168318 12 Left 1067168313 10:43883039-43883061 CCCAGGGCAAGGCTTTCTCTAGT No data
Right 1067168318 10:43883074-43883096 CCTCGAACTGTGTCAACCTTGGG No data
1067168314_1067168318 11 Left 1067168314 10:43883040-43883062 CCAGGGCAAGGCTTTCTCTAGTT No data
Right 1067168318 10:43883074-43883096 CCTCGAACTGTGTCAACCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067168318 Original CRISPR CCTCGAACTGTGTCAACCTT GGG Intergenic
No off target data available for this crispr