ID: 1067168402

View in Genome Browser
Species Human (GRCh38)
Location 10:43883674-43883696
Sequence GTTTTTAAGGGCATTGTTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067168402_1067168406 -6 Left 1067168402 10:43883674-43883696 CCCAGAACAATGCCCTTAAAAAC No data
Right 1067168406 10:43883691-43883713 AAAAACATTTCCTATGTCTTAGG No data
1067168402_1067168409 28 Left 1067168402 10:43883674-43883696 CCCAGAACAATGCCCTTAAAAAC No data
Right 1067168409 10:43883725-43883747 TTTGGTATTCTAAAGAGACTTGG No data
1067168402_1067168408 10 Left 1067168402 10:43883674-43883696 CCCAGAACAATGCCCTTAAAAAC No data
Right 1067168408 10:43883707-43883729 TCTTAGGTAAACTCTGCATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067168402 Original CRISPR GTTTTTAAGGGCATTGTTCT GGG (reversed) Intergenic
No off target data available for this crispr