ID: 1067177902

View in Genome Browser
Species Human (GRCh38)
Location 10:43962948-43962970
Sequence TTGTGGTTATGTAAGGAATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067177902_1067177905 22 Left 1067177902 10:43962948-43962970 CCAAATTCCTTACATAACCACAA No data
Right 1067177905 10:43962993-43963015 ATAATAATGAACACACTTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067177902 Original CRISPR TTGTGGTTATGTAAGGAATT TGG (reversed) Intergenic
No off target data available for this crispr