ID: 1067183698

View in Genome Browser
Species Human (GRCh38)
Location 10:44009385-44009407
Sequence TTAGGTTACCATTTCAAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067183698_1067183701 -2 Left 1067183698 10:44009385-44009407 CCTGTCTTGAAATGGTAACCTAA No data
Right 1067183701 10:44009406-44009428 AATAATCTTCCCAGTCCTCAGGG No data
1067183698_1067183702 4 Left 1067183698 10:44009385-44009407 CCTGTCTTGAAATGGTAACCTAA No data
Right 1067183702 10:44009412-44009434 CTTCCCAGTCCTCAGGGAGATGG No data
1067183698_1067183700 -3 Left 1067183698 10:44009385-44009407 CCTGTCTTGAAATGGTAACCTAA No data
Right 1067183700 10:44009405-44009427 TAATAATCTTCCCAGTCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067183698 Original CRISPR TTAGGTTACCATTTCAAGAC AGG (reversed) Intergenic
No off target data available for this crispr