ID: 1067184270

View in Genome Browser
Species Human (GRCh38)
Location 10:44013894-44013916
Sequence GAGTATTAGTTCCAGGAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067184270_1067184276 -8 Left 1067184270 10:44013894-44013916 CCTGTCTCCTGGAACTAATACTC No data
Right 1067184276 10:44013909-44013931 TAATACTCATCTAGAGGGGTGGG No data
1067184270_1067184281 24 Left 1067184270 10:44013894-44013916 CCTGTCTCCTGGAACTAATACTC No data
Right 1067184281 10:44013941-44013963 TGCTACTGTGCCCCCTGCAATGG No data
1067184270_1067184275 -9 Left 1067184270 10:44013894-44013916 CCTGTCTCCTGGAACTAATACTC No data
Right 1067184275 10:44013908-44013930 CTAATACTCATCTAGAGGGGTGG No data
1067184270_1067184282 30 Left 1067184270 10:44013894-44013916 CCTGTCTCCTGGAACTAATACTC No data
Right 1067184282 10:44013947-44013969 TGTGCCCCCTGCAATGGTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067184270 Original CRISPR GAGTATTAGTTCCAGGAGAC AGG (reversed) Intergenic
No off target data available for this crispr